ID: 1018619267

View in Genome Browser
Species Human (GRCh38)
Location 6:165714725-165714747
Sequence GCACAGACTCCTGTTTCTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018619267_1018619270 7 Left 1018619267 6:165714725-165714747 CCTAAAGAAACAGGAGTCTGTGC No data
Right 1018619270 6:165714755-165714777 GGATGCACCCCCAGAGTCTCAGG No data
1018619267_1018619271 11 Left 1018619267 6:165714725-165714747 CCTAAAGAAACAGGAGTCTGTGC No data
Right 1018619271 6:165714759-165714781 GCACCCCCAGAGTCTCAGGCAGG 0: 1
1: 0
2: 4
3: 40
4: 422
1018619267_1018619273 14 Left 1018619267 6:165714725-165714747 CCTAAAGAAACAGGAGTCTGTGC No data
Right 1018619273 6:165714762-165714784 CCCCCAGAGTCTCAGGCAGGAGG 0: 1
1: 0
2: 3
3: 58
4: 779

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018619267 Original CRISPR GCACAGACTCCTGTTTCTTT AGG (reversed) Intronic