ID: 1018619839

View in Genome Browser
Species Human (GRCh38)
Location 6:165719492-165719514
Sequence CTGGTTGAACATGTTGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018619837_1018619839 -9 Left 1018619837 6:165719478-165719500 CCTGGAATTCTGTACTGGTTGAA 0: 1
1: 0
2: 2
3: 24
4: 248
Right 1018619839 6:165719492-165719514 CTGGTTGAACATGTTGTGGTAGG 0: 1
1: 0
2: 1
3: 9
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018619839 Original CRISPR CTGGTTGAACATGTTGTGGT AGG Intronic
902666361 1:17941702-17941724 CTGGCTCAACTTGTTGGGGTGGG - Intergenic
905088506 1:35406856-35406878 GTGGATCAACATGTTGTAGTAGG + Intronic
907067027 1:51494275-51494297 CTGGAAGAAGAGGTTGTGGTTGG - Intronic
911068968 1:93817088-93817110 TTGGTTGAACAGGATGTGGGGGG - Intronic
920564729 1:206964284-206964306 GTGGTTCAACATCTTGCGGTAGG + Intronic
1064661249 10:17610173-17610195 ATGGATGAACAATTTGTGGTAGG + Intronic
1068406355 10:56594684-56594706 CTGTTTGGAGATGTTGTGGGAGG - Intergenic
1070576950 10:77686534-77686556 CTGGTTGAGTTTGCTGTGGTGGG + Intergenic
1072801615 10:98396145-98396167 CAGGTTAACCAAGTTGTGGTGGG - Intronic
1074106890 10:110395359-110395381 CTGGTTCAGCAGGTTGGGGTAGG + Intergenic
1076194253 10:128504218-128504240 CTGGGAGAACATGGTCTGGTGGG - Intergenic
1077310256 11:1885463-1885485 CTGGATGAAGTTGTTTTGGTTGG - Intronic
1078980746 11:16530551-16530573 TTGCTTGAACATGAGGTGGTTGG - Intronic
1081096282 11:38940103-38940125 CTGGTTGTAAAGGTTTTGGTAGG - Intergenic
1083428132 11:62600002-62600024 CTGTTTTTACATGTTGGGGTTGG - Intronic
1084856967 11:71995652-71995674 ATGGTTTGACATGTTCTGGTTGG - Intronic
1086009525 11:82083326-82083348 CTGGCTTAGCATGTGGTGGTAGG + Intergenic
1092418781 12:8312882-8312904 CTGGGTCAGGATGTTGTGGTCGG - Intergenic
1093316718 12:17660839-17660861 CTGGCTGAATATCTTGTGGTTGG - Intergenic
1095548584 12:43403930-43403952 ATGGGTGAACGTGTTGGGGTGGG - Intronic
1099530790 12:83778071-83778093 GTGGTAGAACAAGTGGTGGTGGG - Intergenic
1101222424 12:102655314-102655336 CTGGTTGATCATGGTGTCCTTGG + Intergenic
1101448780 12:104757328-104757350 CTGGGTGAACTTGTTGCGGTAGG - Exonic
1106118337 13:26836780-26836802 CTGAGTGCACATGTTGTGGGAGG - Intergenic
1106213496 13:27673226-27673248 CTGGTTGAACAGGTGGTGTTTGG - Intergenic
1106624682 13:31408551-31408573 CTCTTTGAACAGGTTTTGGTTGG + Intergenic
1109175051 13:59144814-59144836 CTTGTTGAACATGGAGTGGAAGG + Intergenic
1111150764 13:84251507-84251529 CTCATTGAACATGTTATAGTGGG + Intergenic
1111305450 13:86407112-86407134 TTGGTTGAAAATGTTTTTGTTGG - Intergenic
1113561975 13:111288507-111288529 CTGAAGGAACCTGTTGTGGTAGG + Intronic
1113773417 13:112927504-112927526 CTGGTAGAACAAGATGTTGTAGG - Intronic
1116971111 14:51067150-51067172 CTAGTTTAACATGTTGAGGGAGG - Intronic
1118819908 14:69338537-69338559 CTGGAGGTACATGTTGGGGTCGG - Intronic
1120568987 14:86094395-86094417 ATGGTTGAAAATGTTGAGCTGGG - Intergenic
1120844463 14:89113841-89113863 CAGGTTGGATAGGTTGTGGTTGG - Intergenic
1123103320 14:105820368-105820390 CTGATGGACCATGCTGTGGTAGG + Intergenic
1123799755 15:23807727-23807749 CATGTTGAACATGTTGAGATGGG + Intergenic
1123824295 15:24066027-24066049 CGGTTTGAACAAGTTGTGGAAGG - Intergenic
1123938963 15:25207572-25207594 CTGGTTGGCCATGTGCTGGTTGG + Intergenic
1125156354 15:36591047-36591069 CAGGGTGAAAATTTTGTGGTTGG + Intronic
1126299169 15:47175756-47175778 GTGGTTGCACATGTTGTGACTGG - Intergenic
1131567283 15:93497883-93497905 ATGGATGAACATGCTGTGGTAGG + Intergenic
1142191418 16:88719948-88719970 CTGGTTGAACATCCTGGGGCGGG + Exonic
1143757073 17:9075009-9075031 CAGCCTCAACATGTTGTGGTCGG + Intronic
1149299964 17:55296069-55296091 TTGGTTGGACAGGTTTTGGTTGG + Intronic
1151423523 17:74014553-74014575 CAGGCTGGACATGTTGTGATGGG - Intergenic
1159176279 18:64839043-64839065 CTGGTTGAAGGTGTTTGGGTCGG - Intergenic
1162048662 19:8018617-8018639 CTGGTTGAAGATTTTGAGATGGG + Intronic
1164213782 19:23124935-23124957 CAGTTTCTACATGTTGTGGTAGG + Intronic
1168027726 19:53655490-53655512 CGGTTTGAACAAGTTGTGGAAGG + Intergenic
926516904 2:13858169-13858191 CTCCTGGAACATTTTGTGGTTGG - Intergenic
928897535 2:36282353-36282375 CTTGTTGATCATGTTCTGGAAGG - Intergenic
929634905 2:43509241-43509263 CTGGTTGAAAATTTTGTGGTAGG - Intronic
938710992 2:133976179-133976201 CTAGTTGAGCATGTGGAGGTTGG + Intergenic
939005746 2:136785049-136785071 CTGGTGGCACTTGTTGTGGGAGG + Intronic
942531870 2:176919044-176919066 GGGGTTGATCATATTGTGGTTGG - Intergenic
943777101 2:191778028-191778050 ATGGTTAAACATTTTGAGGTGGG + Intergenic
945111077 2:206360435-206360457 CTGGGTGAACATTTTTTGGGTGG + Intergenic
946552239 2:220815331-220815353 CTGATTGAAAATGTTCTGATTGG - Intergenic
948637323 2:239347889-239347911 CTGGTTGAGCAGGCAGTGGTCGG - Intronic
1175461008 20:59151919-59151941 ATGGTTGAACATGCTGGTGTGGG + Intergenic
1182658197 22:31906286-31906308 CTCGCAGAACATGTTCTGGTTGG - Exonic
952172164 3:30819066-30819088 CTGCTTGAACATATTGACGTGGG + Intronic
952622936 3:35367908-35367930 GTGAGTGAACATGTTCTGGTGGG - Intergenic
959659450 3:108849845-108849867 GAGGTTGAACAGATTGTGGTAGG - Intronic
961000239 3:123369224-123369246 CTTGTTCATCATGATGTGGTGGG - Intronic
962971038 3:140402282-140402304 CTGTTTGGAGATGGTGTGGTGGG + Intronic
963528971 3:146449336-146449358 CTTGATGAACAAATTGTGGTTGG - Exonic
965638581 3:170809571-170809593 CTGGTTTAAGATTTTGAGGTGGG - Intronic
967423366 3:189298245-189298267 CTGATTTAACAGGTTGTGATGGG + Intronic
967538913 3:190641731-190641753 CTGGATGAACATTTTGTAATGGG - Intronic
967869587 3:194218840-194218862 CTCCTTGTACATGATGTGGTGGG - Intergenic
967887230 3:194341533-194341555 CAGGTTGAACAGGTTGTAGTTGG + Exonic
973814010 4:54601951-54601973 ATGTTTGAACAAGTTGTGGAAGG - Intergenic
974295197 4:59989045-59989067 CTGGTCTAACTTGTTGTGGATGG + Intergenic
975446466 4:74471397-74471419 CTGTTTGAACTTGTTCTGGGAGG + Intergenic
978085895 4:104653642-104653664 CTTCTTAAACCTGTTGTGGTGGG - Intergenic
981288335 4:143045822-143045844 CTGTCTGAAGAGGTTGTGGTTGG - Intergenic
989742282 5:44787745-44787767 ATGTTTGAACAAGTTGTGGAAGG - Intergenic
990176386 5:53112940-53112962 CTCTTTGAACCTGTTCTGGTTGG - Intergenic
990275560 5:54192298-54192320 TAGTTAGAACATGTTGTGGTGGG - Intronic
992014843 5:72565320-72565342 CTGGTTGAACATATTCTGGCTGG - Intergenic
992072438 5:73160294-73160316 TTGATTGAACACATTGTGGTTGG - Intergenic
1000018992 5:157302868-157302890 CTGGGTGATCCTGTTGTGGTTGG - Exonic
1001295797 5:170498007-170498029 CCGGTTGATCATGTTCTGGAGGG - Intronic
1001854011 5:174995096-174995118 CTGCTTGAGCATCTTGGGGTGGG + Intergenic
1001989626 5:176105556-176105578 CAGGTGGCACAGGTTGTGGTGGG + Intronic
1002227244 5:177732582-177732604 CAGGTGGCACAGGTTGTGGTGGG - Intronic
1002266898 5:178041188-178041210 CAGGTGGCACAGGTTGTGGTGGG + Intronic
1004813956 6:19292153-19292175 CTGATTGCACATATTGTAGTTGG - Intergenic
1005668587 6:28081661-28081683 ATGGATGAACATGTCTTGGTGGG - Intronic
1005809427 6:29504939-29504961 TTAGATGAAGATGTTGTGGTGGG - Intergenic
1010022091 6:71172183-71172205 TAGGTTGATTATGTTGTGGTTGG + Intergenic
1010082630 6:71881905-71881927 CTGGATGAACATGGTTTTGTAGG + Intergenic
1011241669 6:85278108-85278130 CTGGTTAAATATGTTGATGTTGG - Intergenic
1014202946 6:118624802-118624824 CTTGTTGGACATGTTGTTTTTGG - Intronic
1014883482 6:126750936-126750958 CTGGTTGGACTTTTTTTGGTTGG - Intergenic
1017297463 6:152815118-152815140 ATGGTTAAACATGTTTTGGTGGG - Intergenic
1018619839 6:165719492-165719514 CTGGTTGAACATGTTGTGGTAGG + Intronic
1020541878 7:9469045-9469067 TAGGTTGAATAGGTTGTGGTGGG - Intergenic
1026204126 7:68240767-68240789 CTGGTTGAACATGAAGCAGTAGG - Intergenic
1028585273 7:92446298-92446320 CTTGATGAATATATTGTGGTGGG - Intergenic
1031463669 7:122082251-122082273 CTAGATGAGCATGTTGTGATGGG - Intronic
1033418696 7:141186644-141186666 CTCGTTCAACATCTTGTGCTGGG + Intronic
1033837929 7:145337818-145337840 CTGGATGAACATGATTTTGTGGG + Intergenic
1034390208 7:150781142-150781164 TTGGTTGAAATTGTTGTGGTGGG - Intergenic
1036369466 8:8150339-8150361 CTGGGTCAGGATGTTGTGGTCGG + Intergenic
1036881422 8:12515306-12515328 CTGGGTCAGGATGTTGTGGTCGG - Intergenic
1038240575 8:25804353-25804375 TTAGTTGATCATGTTGAGGTTGG + Intergenic
1040697287 8:50015844-50015866 CTGCTTGAAGAAGTTGTAGTCGG + Intronic
1041003539 8:53476795-53476817 CTGGATGGACCTGTTCTGGTTGG - Intergenic
1041355209 8:56993226-56993248 CAGGTAGAACATCTTGCGGTTGG + Exonic
1041534842 8:58914635-58914657 TTGGTTGAACAAGTTTTTGTGGG - Intronic
1042400952 8:68346383-68346405 CTGGTGGAGGATGTTGTGATGGG - Intronic
1043635873 8:82381090-82381112 TTGGTTCAAAATGTTGTTGTTGG - Intergenic
1050049059 9:1578919-1578941 ATGGTTGAGTATTTTGTGGTGGG + Intergenic
1051229885 9:14945092-14945114 GTCGTTGAACATCTTGTGGCTGG - Intergenic
1054989386 9:71304947-71304969 CTAGTTGAACATTTTTTAGTAGG + Intronic
1061348416 9:130044286-130044308 CAGGTTGAAAATGGTGGGGTGGG - Intergenic
1198816545 X:140597845-140597867 CTGTTTGAAGATTTGGTGGTGGG - Intergenic