ID: 1018621606

View in Genome Browser
Species Human (GRCh38)
Location 6:165734269-165734291
Sequence GACACGCCTGGGCCACCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 192}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018621600_1018621606 4 Left 1018621600 6:165734242-165734264 CCCACACTGGGTGGGCTTCGGGG 0: 1
1: 0
2: 0
3: 7
4: 113
Right 1018621606 6:165734269-165734291 GACACGCCTGGGCCACCTCCAGG 0: 1
1: 0
2: 1
3: 17
4: 192
1018621602_1018621606 3 Left 1018621602 6:165734243-165734265 CCACACTGGGTGGGCTTCGGGGA 0: 1
1: 0
2: 0
3: 10
4: 134
Right 1018621606 6:165734269-165734291 GACACGCCTGGGCCACCTCCAGG 0: 1
1: 0
2: 1
3: 17
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018621606 Original CRISPR GACACGCCTGGGCCACCTCC AGG Intronic
900654213 1:3747116-3747138 GACTGGCCTCGGTCACCTCCCGG - Intergenic
900852636 1:5156111-5156133 GCCACACCAGGGCCACCTGCTGG - Intergenic
900932062 1:5743784-5743806 CCCAGGCCTGGGCCACCTCAGGG - Intergenic
901184155 1:7361474-7361496 GAGAAGCCTGGGACACCTCCTGG + Intronic
901510202 1:9714581-9714603 GACACACCTTGGACCCCTCCAGG + Intronic
901737872 1:11323802-11323824 GCCCAGCCTGGGCCATCTCCAGG + Intergenic
902632753 1:17715395-17715417 GATAGGCCTGGGCCAAATCCTGG - Intergenic
903214114 1:21833722-21833744 GCCAAGCCTGTGCCACATCCTGG + Intronic
903220142 1:21864917-21864939 GCCCCGGCTGGGCGACCTCCAGG + Exonic
903860977 1:26364412-26364434 GGCACTCCTGGGCAACCTCTAGG - Intronic
904342421 1:29845493-29845515 GACCCACCAGGGCCACTTCCAGG + Intergenic
904476093 1:30765473-30765495 GACAAACCTGGCCCACATCCCGG + Intergenic
907276725 1:53320898-53320920 GACAGACCTGGGTCAGCTCCTGG + Intronic
907642153 1:56201806-56201828 GGCAGGGCTGCGCCACCTCCAGG + Intergenic
908750402 1:67417050-67417072 TACACACCTGTGCCAACTCCTGG - Intronic
910461347 1:87451033-87451055 GCCACGCCTGGGGCGCCTCCTGG + Intergenic
910776915 1:90886200-90886222 GTCAGGCCTGGGCCACTGCCAGG - Intergenic
914086834 1:144461473-144461495 GCCACGCCTCGGCCCGCTCCTGG + Intronic
914318574 1:146537352-146537374 GCCACGCCTGGGGTGCCTCCTGG + Intergenic
914495786 1:148196005-148196027 GCCACGCCTGGGGTGCCTCCTGG - Intergenic
914750686 1:150532995-150533017 GTCAATCCTGGGCCACCTCAGGG - Intergenic
915735262 1:158080635-158080657 TACACGCCTGGGCAAACACCTGG + Intronic
917661583 1:177181917-177181939 GCCACTCCTCGGCAACCTCCGGG - Intronic
917798988 1:178553147-178553169 GACAAGCCAGGGCCACTCCCTGG + Intergenic
918610931 1:186490951-186490973 TACAGGCCTGAGCCACCACCTGG + Intergenic
922003419 1:221503972-221503994 GACCCGTCGGGTCCACCTCCAGG + Intergenic
1070314223 10:75295203-75295225 GGCCCGCCTGGGCGACCCCCGGG + Intergenic
1070767903 10:79067177-79067199 CCCCCGCCTGGGCCGCCTCCGGG + Intergenic
1071545280 10:86524300-86524322 GACACCCCTCGGGCCCCTCCTGG + Intergenic
1072665494 10:97389635-97389657 CACAGGCCTGGCGCACCTCCTGG - Intronic
1075028880 10:119007611-119007633 AACACTCCAGGGTCACCTCCGGG + Intergenic
1076525636 10:131110859-131110881 CACACGCATGGGGCACCTCCAGG - Intronic
1077187917 11:1243701-1243723 GCCACACCACGGCCACCTCCAGG + Exonic
1077188343 11:1245372-1245394 GCCACACCAGGGCCACCTCCAGG + Exonic
1077188876 11:1247472-1247494 GCCACACCAGGGGCACCTCCAGG + Exonic
1077189298 11:1249143-1249165 GCCACACCACGGCCACCTCCAGG + Exonic
1077575026 11:3376417-3376439 CACAGGCCTGGGCCACATGCTGG - Intronic
1078068850 11:8095463-8095485 GACACGCCTGAGTTACATCCAGG - Intronic
1081611469 11:44565625-44565647 GTCACTCCTCGGCCCCCTCCCGG - Exonic
1081669912 11:44937127-44937149 GCCACGCCTGTGCCTTCTCCAGG - Intronic
1082074625 11:47966787-47966809 TGCACGCCTGGGCCATATCCAGG - Intergenic
1083308493 11:61772757-61772779 GAAGTGCCTGGGCCACTTCCGGG - Intronic
1083780309 11:64914162-64914184 GACACTCCTGGGCCAGCTGCAGG + Exonic
1084064050 11:66693308-66693330 GAAACGCCTGGGCCACGAGCTGG - Exonic
1084296646 11:68216472-68216494 GCCACTCCTAGGCCAGCTCCGGG - Intergenic
1084655018 11:70510087-70510109 GTCACTCCTGGGTCACCTGCTGG - Intronic
1087614139 11:100469131-100469153 AACAGGCTTTGGCCACCTCCTGG + Intergenic
1089353424 11:117834307-117834329 GACACTCCTGGTCCTCCTCATGG + Intronic
1091277242 11:134360876-134360898 GACAGGCCTGAGCCACTGCCCGG - Intronic
1099483335 12:83196171-83196193 TACAGGCATGAGCCACCTCCCGG - Intergenic
1101824697 12:108210979-108211001 GGCACTCCTGGGTCCCCTCCTGG + Intronic
1103276027 12:119712542-119712564 GCCAAGCCCGGCCCACCTCCAGG + Intronic
1103727358 12:123004763-123004785 GACAGGCCTGGGTCCACTCCTGG + Intronic
1103849935 12:123926317-123926339 GACACGCCTGTGGAACCTCAGGG + Intronic
1103904174 12:124319053-124319075 GACACTCCTGGGCCCCCACAGGG + Intergenic
1104751923 12:131245372-131245394 GCCACACTTGGGCCTCCTCCTGG - Intergenic
1104779969 12:131413703-131413725 GCCACACTTGGGCCTCCTCCTGG + Intergenic
1105293787 13:19071352-19071374 CCCACCCCTGGGCCACCTGCTGG + Intergenic
1106410283 13:29506520-29506542 AACACCCCAGGGCCACCTCTGGG + Intergenic
1107951328 13:45464962-45464984 GAGAGACCTGGGCCACTTCCGGG - Exonic
1113886908 13:113665866-113665888 GACACACCTGGGGCACATCTTGG - Intergenic
1114534931 14:23416861-23416883 CACACACCTCGGCCTCCTCCAGG + Exonic
1120764380 14:88315279-88315301 GACTAACCTGGGCCAGCTCCTGG - Intronic
1121801365 14:96777005-96777027 GAGATGGCTGGGGCACCTCCCGG + Intergenic
1122939104 14:104973341-104973363 TTCACGCCTTGGCCTCCTCCCGG - Intronic
1122961537 14:105096183-105096205 GCCTCCCCTGGGCCAGCTCCAGG + Intergenic
1123440684 15:20289039-20289061 GACCAGCCTGGGCCACATACTGG - Intergenic
1125579343 15:40774502-40774524 GACAAGCCTGGGCTACCTTGAGG + Intronic
1127811455 15:62568803-62568825 GACACAGCTGGGCATCCTCCAGG - Intronic
1131268019 15:90930137-90930159 GACAGCCCCGGGCCACTTCCGGG + Exonic
1131435239 15:92416735-92416757 GGCAGGCCTTGCCCACCTCCTGG + Intronic
1131449559 15:92528051-92528073 GCCCCTCCTGGGCCAGCTCCTGG + Intergenic
1132546307 16:534935-534957 GACACGCCTGTGTCACCTGCGGG + Intronic
1133780618 16:8936241-8936263 GATACGCATGGGCCAACACCTGG + Intronic
1133814254 16:9184302-9184324 GCCATGCCTGAGCCTCCTCCCGG - Intergenic
1135327985 16:21539551-21539573 GACACTCCTGGGCTTCCTTCTGG - Intergenic
1136015199 16:27393965-27393987 GACAGGCATGAGCCACCACCTGG - Intergenic
1136338338 16:29625575-29625597 GACACTCCTGGGCTTCCTTCTGG - Intergenic
1136525290 16:30825728-30825750 GACCCGCCTGAGCCACCTCCAGG + Intergenic
1139448254 16:67011847-67011869 GGCAGGCCTGGGCTAGCTCCTGG - Intergenic
1141644463 16:85359830-85359852 GACCAGCCTGGGCAACCCCCAGG + Intergenic
1141786940 16:86207424-86207446 GCCATGCCTGGGCCACCTCATGG - Intergenic
1141952603 16:87348463-87348485 AACACGCCTGGGCCCCCTAATGG + Intronic
1142196683 16:88742309-88742331 GCCCCGCCTGGACCAGCTCCTGG - Exonic
1142214721 16:88824909-88824931 GACACGCTGGGGCCACCTGGAGG + Intronic
1142388558 16:89783006-89783028 GACACGGCTGGCCGACCTCAAGG - Exonic
1145756854 17:27398484-27398506 GACTTGTCTGAGCCACCTCCTGG - Intergenic
1146476135 17:33164159-33164181 GACAGGCCTGGGCCAGCCCCAGG - Intronic
1147339548 17:39745514-39745536 TCCAGGCCTGGGCCTCCTCCAGG - Exonic
1147943215 17:44065157-44065179 TACAGGCCTGAGCCACCGCCCGG - Intronic
1148885030 17:50766199-50766221 CACAGCCCTGAGCCACCTCCAGG - Intergenic
1152612490 17:81322644-81322666 GACAGGCGTCGGCCACCACCCGG - Intronic
1159732142 18:72041517-72041539 GACATGCATATGCCACCTCCTGG + Intergenic
1160222995 18:76990820-76990842 GACACACCTGGGGCAGCTACGGG + Intronic
1160985249 19:1835673-1835695 GACTGACCTGGGCCACATCCAGG - Intronic
1162361717 19:10224374-10224396 GAACTGCCTGGGCCACCTCGAGG - Exonic
1162524723 19:11200795-11200817 AAAACACCTGGGCCACCTCCAGG + Exonic
1163008159 19:14409169-14409191 GACCCGCCCGGGCCACCTGCAGG + Exonic
1163296875 19:16418261-16418283 GGAACCCCTGGGCCACTTCCTGG - Intronic
1163408057 19:17135988-17136010 GACACCCCAGGGCCACCAACAGG + Intronic
1163614531 19:18318826-18318848 GACCCTCTTGGGCCACCACCTGG + Intronic
1163862068 19:19747834-19747856 GACCCGCCTGTGCCTCCTGCTGG - Intergenic
1165635224 19:37334653-37334675 AACGCGCCTGGGCCACCGACCGG - Intronic
1166782984 19:45352001-45352023 GCCGTGCCTGGGCCACCTGCTGG + Intronic
1166869852 19:45864510-45864532 GACACACCTCGCCCGCCTCCGGG - Exonic
1167290800 19:48624411-48624433 CACACGCCGGGTCCTCCTCCAGG - Intronic
1167463553 19:49638686-49638708 AAAACCCCTGAGCCACCTCCGGG - Intronic
1167483007 19:49744785-49744807 GACAAGCCTGGGCCACATAGCGG - Intronic
1167698940 19:51030989-51031011 GACATGGATGGGCCACATCCAGG - Intronic
1168293610 19:55368869-55368891 GTCGCCCCTGGGCCACCACCTGG - Exonic
925221413 2:2144285-2144307 CCCACGCCTGGGCCACCTTCAGG + Intronic
925300193 2:2806316-2806338 CACACGGCCGGGCCACCCCCCGG + Intergenic
927641648 2:24849298-24849320 GACACTGCTGAGCCTCCTCCCGG + Intronic
930638786 2:53834423-53834445 TACAGGCGTGGGCCACCGCCCGG - Intergenic
935175151 2:100642705-100642727 GACCCTCCTGGGCCAGCTTCAGG + Intergenic
937985912 2:127638019-127638041 GATACGCCTGCGCTACCCCCAGG + Intergenic
941024508 2:160443469-160443491 GAATAGCCTGGGCCATCTCCTGG + Intronic
942686935 2:178542542-178542564 GACAAGCCTGGTCCACCAACAGG - Exonic
946398028 2:219453112-219453134 GCCAGGCCTGGGCCCCCTCAGGG - Intronic
948076984 2:235172535-235172557 TCCACGCCTAGGCCCCCTCCAGG - Intergenic
948633685 2:239319439-239319461 GCCAGGCGAGGGCCACCTCCCGG + Intronic
948684950 2:239664524-239664546 GAGACCCCTCTGCCACCTCCTGG + Intergenic
1168808129 20:684850-684872 CATGCACCTGGGCCACCTCCTGG - Intergenic
1169781622 20:9316256-9316278 CATACGCCTGGGCCAGTTCCTGG - Intronic
1173792163 20:45834585-45834607 AAAGCGCCTGGGCCACCTCTTGG + Intronic
1174504759 20:51010059-51010081 GACGCGCCTGGGCCAGCTCAAGG - Exonic
1175579704 20:60088772-60088794 AACAGGCCTGGGTCACCTTCTGG - Intergenic
1176309600 21:5142651-5142673 CACAGGCCTGGGCCAGCTGCTGG - Exonic
1179801616 21:43813843-43813865 GGCACCCCTTGGGCACCTCCTGG + Intergenic
1179847460 21:44119382-44119404 CACAGGCCTGGGCCAGCTGCTGG + Exonic
1180139203 21:45881012-45881034 GACATGCCTGGGCCAGCTGCGGG + Intronic
1180570940 22:16718140-16718162 GACAGCCCTGCGCCACCACCAGG - Intergenic
1181069267 22:20322436-20322458 GGGACTCCTGGGCCACCTCTGGG + Intergenic
1181111265 22:20604333-20604355 GGTACGCCAGGGCCTCCTCCAGG + Intergenic
1182228608 22:28819465-28819487 TCCATGCCTGGGCAACCTCCAGG - Intergenic
1183543530 22:38443502-38443524 GTCAGGCCTGAGCGACCTCCTGG - Intronic
1183605415 22:38864794-38864816 GCCAGCCCTGGGCCACTTCCCGG - Exonic
1183872320 22:40749119-40749141 GACATGCCTGGACCAGCTGCGGG + Intergenic
1183883332 22:40856196-40856218 TACACCCCTGGGCAACCTCAGGG + Intronic
1183946601 22:41329871-41329893 GACAAGCCAGGGACACCTCCTGG + Intronic
1184368504 22:44067992-44068014 GACATGCCTGGCCCACTCCCAGG - Intronic
1184769402 22:46588807-46588829 GCCCAGCCTGGGCCACATCCAGG - Intronic
1184791322 22:46701903-46701925 GACAGGCGTGAGCCACCGCCCGG - Intronic
950425360 3:12922289-12922311 GACACGCCCAGCCCACCCCCAGG + Intronic
950572731 3:13811940-13811962 GACACACACGGGCCACCCCCAGG - Intergenic
952405170 3:32998761-32998783 GCCATGGCTGGGCCTCCTCCAGG - Intronic
954425363 3:50440220-50440242 GACAGGCCTTAGCCCCCTCCTGG - Intronic
954870550 3:53764514-53764536 GACAGACCTTGGCCACATCCTGG - Intronic
961485074 3:127210507-127210529 GAGGCGCCTGGGCTAACTCCAGG + Intergenic
964530168 3:157658863-157658885 GACACTGCTGGTACACCTCCAGG + Intronic
966910527 3:184557141-184557163 GAGCCGCCTGGCCCCCCTCCAGG - Intronic
968192091 3:196675925-196675947 GACAGGCGTGAGCCACCACCTGG + Intronic
980241892 4:130188749-130188771 GACACGCCAGTGCCATATCCAGG + Intergenic
982165989 4:152614080-152614102 TGCACTGCTGGGCCACCTCCTGG + Intergenic
985487414 5:159193-159215 GGCACACCTGGGCCACCCTCAGG - Intronic
985515690 5:343666-343688 GTCACGCCTGGGCCTCCCCTCGG - Intronic
988939454 5:36128020-36128042 GACACCCCTCCCCCACCTCCAGG + Intronic
991261970 5:64677333-64677355 GACACGCCTGGATCACCTAGAGG + Intergenic
991643465 5:68777152-68777174 GGAACCCCTGGGGCACCTCCAGG + Intergenic
994327562 5:98466385-98466407 TACAGGCCTGAGCCACCGCCTGG - Intergenic
998404096 5:141863840-141863862 GACCCTCCTGGGCCACAGCCTGG - Exonic
999134075 5:149306208-149306230 GACACCCCTGCTCCACCTCAGGG - Intronic
1001047398 5:168385278-168385300 GAGCCTCCTGGGCCACCACCAGG - Exonic
1001564225 5:172689063-172689085 GAGATGCCTGGTCCACCTCTGGG - Exonic
1002071318 5:176680349-176680371 CACCCGCCTGGGCCGGCTCCCGG + Intergenic
1006025888 6:31146494-31146516 GACACTCCTTGGCCTCCTCCTGG - Intronic
1006082376 6:31574961-31574983 GACAAGCCTGGGACAGCCCCGGG - Intergenic
1006686521 6:35839289-35839311 TACAGGCCTGAGCCACCACCTGG + Intronic
1007787691 6:44290692-44290714 GACACCCATGGGCCACACCCAGG + Intronic
1009526387 6:64751503-64751525 GACCTGCCTGGTCCAGCTCCAGG + Intronic
1011795206 6:90945600-90945622 AACATCCCTGGGCCACCCCCTGG - Intergenic
1015522761 6:134147836-134147858 GACCAGCCTGGGACACATCCTGG - Intergenic
1016431679 6:143991844-143991866 GACACCCCTTGGCCACCCCTTGG - Intronic
1016448087 6:144153289-144153311 GACAAGCCTGGGCCAAGTTCAGG - Intronic
1017537405 6:155363334-155363356 GACATGCCTGAGCCTCCCCCAGG + Intergenic
1018621606 6:165734269-165734291 GACACGCCTGGGCCACCTCCAGG + Intronic
1019337864 7:493837-493859 GAGACGCTTCGGCCCCCTCCCGG + Intergenic
1019361004 7:604150-604172 GGCACAACGGGGCCACCTCCTGG + Intronic
1020017336 7:4838617-4838639 GACACGCAGGGGCCACTCCCAGG + Intronic
1020229671 7:6308251-6308273 TACAGGCCTGAGCCACCGCCTGG - Intergenic
1023032056 7:36098459-36098481 GAGACTCCTGGGCCACCTTAAGG - Intergenic
1026055214 7:66977756-66977778 TACAGGCCTGAGCCACCGCCTGG + Intergenic
1026722479 7:72844101-72844123 TACAGGCCTGAGCCACCGCCTGG - Intergenic
1028268557 7:88759196-88759218 GACCCGCCTCTCCCACCTCCCGG - Intergenic
1028294420 7:89110171-89110193 AACACACCTGGTACACCTCCTGG - Intronic
1034699417 7:153083510-153083532 GACAAGGCAGGGCCACCTCAGGG - Intergenic
1035063945 7:156091871-156091893 GACACCCCTGGGCAGCCTTCAGG - Intergenic
1035238799 7:157517083-157517105 GACTCGCCTGGGGCACTTGCTGG - Intergenic
1035292647 7:157849508-157849530 GACCAGCCTGGGCCAACCCCTGG + Intronic
1037099171 8:15021840-15021862 GATACACCTTGACCACCTCCTGG + Intronic
1037696435 8:21228149-21228171 CACAGGCCTGGCCCACTTCCTGG - Intergenic
1038244309 8:25840483-25840505 GACAAGGCAGGGCCACCTCTGGG + Intergenic
1038253562 8:25928848-25928870 GCCAAGCCTGGTCCACTTCCTGG - Intronic
1039980533 8:42406259-42406281 GACACTTCTGGGACTCCTCCTGG + Intergenic
1045430890 8:102114256-102114278 GACTCTGCTGGGCCAGCTCCTGG - Intronic
1046956493 8:120067829-120067851 GACAGGCCTGGGGAACCACCTGG - Intronic
1049224822 8:141445155-141445177 GAGCTGCCGGGGCCACCTCCAGG + Intergenic
1049408104 8:142460615-142460637 GACACTTCTGGGCCATCTCCTGG + Intronic
1049755760 8:144310715-144310737 CCCACCCCTGAGCCACCTCCAGG + Intronic
1057212672 9:93209260-93209282 GACAGGCCTGTGGCACCTCAAGG + Intronic
1060939486 9:127535397-127535419 GACATGCCTGGGCCTTCTCCTGG - Intronic
1061013358 9:127968156-127968178 GGCATGCCTAGGCCACCTGCTGG - Intronic
1061290367 9:129647327-129647349 GACAGGCCTGGACCCCCTGCTGG - Intergenic
1061497892 9:130986126-130986148 GACCAGCCTGGGCAACCTACTGG - Intergenic
1061576977 9:131513480-131513502 GCCAGGCCTGGGTCCCCTCCCGG - Intronic
1062047696 9:134432046-134432068 GAGGTGCCTGGGCCTCCTCCTGG + Intronic
1062128709 9:134880927-134880949 GGCACTCCAGGGCCTCCTCCTGG + Intronic
1062151488 9:135021471-135021493 GACACGCCAGGTCCAGCTCGGGG + Intergenic
1062392570 9:136339809-136339831 GGCAGGCCTGGCTCACCTCCTGG - Exonic
1062414590 9:136441806-136441828 TCCAGGCCTGCGCCACCTCCGGG - Exonic
1192680013 X:73242413-73242435 GACACTGCTGGGCCAACTCAGGG + Intergenic