ID: 1018623260

View in Genome Browser
Species Human (GRCh38)
Location 6:165751802-165751824
Sequence GGACAGGTGCATGCAAATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 134}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018623260_1018623267 22 Left 1018623260 6:165751802-165751824 CCTCAATTTGCATGCACCTGTCC 0: 1
1: 0
2: 1
3: 22
4: 134
Right 1018623267 6:165751847-165751869 GTGAGTAAATGGGCCAGGCACGG No data
1018623260_1018623265 12 Left 1018623260 6:165751802-165751824 CCTCAATTTGCATGCACCTGTCC 0: 1
1: 0
2: 1
3: 22
4: 134
Right 1018623265 6:165751837-165751859 GTAATTGAAAGTGAGTAAATGGG 0: 1
1: 0
2: 1
3: 31
4: 268
1018623260_1018623268 25 Left 1018623260 6:165751802-165751824 CCTCAATTTGCATGCACCTGTCC 0: 1
1: 0
2: 1
3: 22
4: 134
Right 1018623268 6:165751850-165751872 AGTAAATGGGCCAGGCACGGTGG No data
1018623260_1018623264 11 Left 1018623260 6:165751802-165751824 CCTCAATTTGCATGCACCTGTCC 0: 1
1: 0
2: 1
3: 22
4: 134
Right 1018623264 6:165751836-165751858 TGTAATTGAAAGTGAGTAAATGG 0: 1
1: 0
2: 1
3: 30
4: 372
1018623260_1018623266 17 Left 1018623260 6:165751802-165751824 CCTCAATTTGCATGCACCTGTCC 0: 1
1: 0
2: 1
3: 22
4: 134
Right 1018623266 6:165751842-165751864 TGAAAGTGAGTAAATGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018623260 Original CRISPR GGACAGGTGCATGCAAATTG AGG (reversed) Intronic
901131319 1:6963643-6963665 GGACAGGTGCAGGCGGGTTGAGG - Intronic
906606747 1:47178058-47178080 GGACAGGTGGGGGCAAAGTGAGG - Intergenic
909051988 1:70777197-70777219 GGGCAGGTTAATGCAAATTGAGG - Intergenic
909127341 1:71690008-71690030 GGACAAAAGCATCCAAATTGTGG - Intronic
909920221 1:81372459-81372481 GTACAGGTGCTAGCAAATGGGGG - Intronic
911288737 1:96029002-96029024 GGCCAGGTGTGTGCAAACTGGGG - Intergenic
913150009 1:116032293-116032315 GGATGGGTGCATACAATTTGTGG + Intronic
916556948 1:165901432-165901454 GCACAGGTGCATGCACAGAGAGG - Intronic
919450683 1:197769325-197769347 GGTCAGGTGCATGCCAACTTAGG + Intronic
920521372 1:206629636-206629658 AGACAGGTGAATGAAATTTGAGG + Intergenic
920650980 1:207837033-207837055 GGCAAGGGGCATGCTAATTGGGG - Intergenic
922968607 1:229715315-229715337 GGACAGGTTAATGCAAATTGAGG - Intergenic
1063331177 10:5161024-5161046 GCACACGTGCATGCAAATGTAGG - Intergenic
1063624236 10:7674344-7674366 GCTCAGGTGCATGCTAAATGTGG - Intergenic
1063966825 10:11352513-11352535 GGCCAGGTTAATGCAAACTGAGG + Intergenic
1069065857 10:63941339-63941361 GGGCAGCTGGATGCAGATTGTGG + Intergenic
1069604240 10:69729776-69729798 GGACGTGTGCATGCAAAGGGAGG - Intergenic
1072631949 10:97152282-97152304 GGGAAGGTCCCTGCAAATTGAGG + Intronic
1072633468 10:97163148-97163170 GGACAGTTGCATGGAGAATGTGG + Intronic
1073603791 10:104872767-104872789 GGACATGAGCATGCACATTTGGG - Intronic
1073660641 10:105472303-105472325 GGACATGTGCATTCCAAGTGAGG - Intergenic
1077744049 11:4880736-4880758 GGAAAGGTCCAAGCAAAATGTGG + Intronic
1080463195 11:32473562-32473584 GGGCAGGTCAATGCAAACTGAGG - Intergenic
1080995300 11:37592874-37592896 GGTCTTGTGCAAGCAAATTGTGG - Intergenic
1081487552 11:43543580-43543602 GGAAAGGTGCATGGAAGATGAGG - Intergenic
1081592656 11:44435588-44435610 AGACAGGTGTATACAAATTCAGG - Intergenic
1082911181 11:58376080-58376102 GGACATGTGCATGCACATGGAGG - Intergenic
1085087027 11:73675320-73675342 GGACAGGAGCCAGCAAACTGTGG - Intergenic
1085358981 11:75868374-75868396 AGACAGGTGCAAGAGAATTGAGG + Intronic
1085453839 11:76654893-76654915 GGACAGGGGAATGCAGACTGTGG - Intergenic
1085879546 11:80449889-80449911 GAACAAGAACATGCAAATTGAGG - Intergenic
1086900770 11:92365507-92365529 GAACAGGTGCATGATAAATGTGG - Intronic
1090156961 11:124448582-124448604 GGACATGTGCATGCACTTGGTGG - Intergenic
1093055068 12:14547866-14547888 GGGCATGTGCATGCAAACTCTGG + Intronic
1093941401 12:25058890-25058912 GCAAAGGTGAATGCAAATTGTGG + Intronic
1094475959 12:30840744-30840766 GGATGGGTCAATGCAAATTGAGG + Intergenic
1097766278 12:63530818-63530840 GGAGAGCTGAATGCAAATTTTGG - Intergenic
1097782714 12:63726655-63726677 GGAGAGCTGAATGCAAATTTTGG - Intergenic
1098065952 12:66616472-66616494 TGACATGTGCATGCAAATAATGG + Intronic
1102377325 12:112433146-112433168 GGCCAGGTGCCTGTAAATGGTGG - Intronic
1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG + Intronic
1103891576 12:124242789-124242811 ACACAGGTGCATGCACATTCAGG - Intronic
1105600506 13:21882275-21882297 GGACAGAGTCATGCAAAATGAGG - Intergenic
1110497055 13:76180350-76180372 GGGCAGATTAATGCAAATTGAGG - Intergenic
1111198515 13:84904680-84904702 GGACAGGTGCATGAGATTGGTGG - Intergenic
1111508886 13:89233754-89233776 GGACAGGTGAAGGCAAATTCTGG - Intergenic
1111657548 13:91173026-91173048 GGAAAAGTGAATGCAAATTAAGG + Intergenic
1112635260 13:101210185-101210207 GCACATGTGCATGCAGATGGGGG - Intronic
1114850634 14:26378839-26378861 GAACAGGTCAGTGCAAATTGAGG + Intergenic
1116259350 14:42602982-42603004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1121939313 14:98054672-98054694 GGGCAGTTGCACTCAAATTGTGG - Intergenic
1123705812 15:22950440-22950462 GGCCGGGTGCATTCACATTGAGG - Intronic
1123854901 15:24398888-24398910 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1123870931 15:24571872-24571894 GGGCAGATCAATGCAAATTGAGG + Intergenic
1124247050 15:28079840-28079862 TGACAGGTGCAGGCACATGGGGG - Intronic
1128609833 15:69064814-69064836 GGAGGGGTGCATGCAAGGTGGGG - Intergenic
1129981172 15:79872616-79872638 GGGCAGGTCAATGCAAATTGAGG + Intronic
1133475235 16:6114968-6114990 GGACAAGTTAATGCAAACTGAGG + Intronic
1133636254 16:7668545-7668567 GGAGAGGTGCAGGCACAGTGTGG + Intronic
1134567743 16:15265864-15265886 GGAGATGTGCTTGGAAATTGAGG - Intergenic
1138777434 16:59740914-59740936 GGGAAGGTTAATGCAAATTGAGG + Intronic
1140296920 16:73717864-73717886 GGAGGGCTGCATGCAAAGTGTGG - Intergenic
1146087973 17:29847876-29847898 GGGCAGGTTAATGCAAATTGAGG - Intronic
1149731614 17:58952220-58952242 GGACATGTGCATGCACATCATGG + Intronic
1149958118 17:61076267-61076289 GGACAGGTGCCTCAAAAATGTGG + Intronic
1152010502 17:77710430-77710452 GGACAGCTGGATGCAAAGAGGGG - Intergenic
1152771077 17:82169632-82169654 GGAGAGGGGCCTGCAAATAGGGG + Intronic
1152943787 17:83187106-83187128 GAACAGGAGCAGGCAAATTGGGG - Intergenic
1156705433 18:39875775-39875797 AGAAAGCTGCATGCAAAATGTGG - Intergenic
1159337065 18:67081978-67082000 GGTCAAATGCATGCAAATTGAGG - Intergenic
1163015078 19:14449941-14449963 GGACAGACGCAGGCACATTGTGG - Intronic
1165291500 19:34889742-34889764 GTACTGGTGCAAGCAACTTGAGG - Intergenic
928241334 2:29589424-29589446 GGACAGGTTCAGGAAAAGTGTGG + Intronic
931202593 2:60113399-60113421 GGAAAGATGAATGCAAAGTGAGG - Intergenic
931965433 2:67528671-67528693 GTGCAGGTTAATGCAAATTGAGG - Intergenic
932682360 2:73836789-73836811 GCAGAGGTGCATGCACACTGGGG + Intronic
932748645 2:74356562-74356584 AAACAGGTGAATGCAAATTGTGG + Intronic
932861820 2:75301864-75301886 ATACAGATGCATGCAAATTTTGG + Intergenic
933254029 2:80060321-80060343 GGAGAGGCTCCTGCAAATTGTGG + Intronic
941374680 2:164712951-164712973 ACACACGTGCATGCAAATTTTGG + Intronic
943795948 2:191994042-191994064 GGACAGGGGCTTGCATATTGCGG + Intronic
946411884 2:219519488-219519510 GCACACGTGCATGCATATTTTGG - Intronic
1169035415 20:2447151-2447173 GGGCAGGTTGATGCAAATTGAGG - Intergenic
1170828035 20:19813613-19813635 AGACAGGTGCATAAAAATTCTGG + Intergenic
1172570712 20:35968188-35968210 GGGCAGGTTAATGCAAATTAAGG + Intronic
1173308103 20:41871170-41871192 GAACAGGTCAATGCAAATTGAGG - Intergenic
1175776408 20:61656500-61656522 GGACAGGTGCATGGCCAGTGTGG + Intronic
1178670959 21:34591367-34591389 GGACAGTTTCCTGCAAAGTGAGG + Intronic
1180785770 22:18546850-18546872 GGACAGGTGATTTCAATTTGAGG - Intergenic
1181011704 22:20044661-20044683 GGACGGGTGCATGGAGACTGAGG + Intronic
1181242695 22:21486404-21486426 GGACAGGTGATTTCAATTTGAGG - Intergenic
1181736520 22:24886045-24886067 GGACAGGTGCACAGAAGTTGAGG + Intronic
1184965017 22:47965396-47965418 GAACAGGTGTGTGCAAACTGAGG - Intergenic
1185005667 22:48275314-48275336 GGGCAGGTGTAAGCAAATCGTGG + Intergenic
949760252 3:7462737-7462759 GGACAGGTGCAAGCAGATCTAGG - Intronic
950266817 3:11579719-11579741 GGAAAGGTGCATGAAACTTGGGG - Intronic
950899100 3:16480564-16480586 TGACAGTGGCATGCAACTTGAGG + Intronic
953669623 3:44951730-44951752 GGACAGGTGCATGAACAGTAAGG - Intronic
959171773 3:102852819-102852841 GTACAGGTTGATGCAAATTAAGG + Intergenic
959770636 3:110090911-110090933 GGGCAAGTCAATGCAAATTGAGG + Intergenic
959876847 3:111393162-111393184 GGACAGGTCAATGCACACTGAGG - Intronic
960016001 3:112888879-112888901 AAAAAGGTGCATGCAAATTCTGG - Intergenic
960252806 3:115475234-115475256 GGCCAGGAGGATGAAAATTGAGG + Intergenic
961138359 3:124533716-124533738 GGAGAGGTGCAAGCACATTAAGG + Intronic
962076274 3:132085249-132085271 GGAGAGGTATATGAAAATTGAGG + Intronic
967134981 3:186505490-186505512 GAAAAGGTGCACACAAATTGAGG - Intergenic
973301113 4:48585562-48585584 GGACAGGGGCTGGCAAACTGTGG + Intronic
976577891 4:86697348-86697370 GGAAAGATGTATGCAAATTTGGG + Intronic
982625613 4:157762255-157762277 GGAAAGCTGAATGCAAATTTGGG - Intergenic
983882339 4:172947393-172947415 GGACAGGGACATGCAATTTGAGG + Intronic
985136653 4:186792982-186793004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
985700465 5:1368840-1368862 GGACAGGTCAATGCAAATTAAGG - Intergenic
986300283 5:6473089-6473111 GTACAGGAGCAGGAAAATTGGGG - Intronic
996650812 5:125873728-125873750 GGACAGGAGCAGGGAAATTCTGG - Intergenic
997806629 5:136924416-136924438 GGAGAGGGGCTTGCAAAATGAGG - Intergenic
999259637 5:150230011-150230033 TGCCAGGTGCATTCTAATTGTGG - Intronic
1001109508 5:168883926-168883948 CCACAGGTCCATGCAAAGTGGGG + Intronic
1005878524 6:30034949-30034971 GGACTGGTGCATGCACATCTGGG + Intergenic
1005902931 6:30234704-30234726 GAAAAAGTGCATGAAAATTGGGG - Intergenic
1007094953 6:39207474-39207496 AGACAGGTGCAGGCACAGTGCGG + Intronic
1010864449 6:80957133-80957155 GGACTGGTGGCTGCAGATTGTGG - Intergenic
1010865954 6:80976978-80977000 GGGCAGGTCAATGCAAATTGAGG - Intergenic
1010866606 6:80983337-80983359 GGGAAGGTCAATGCAAATTGAGG - Intergenic
1013371223 6:109472621-109472643 GCACATGTGCCTGCAAATAGTGG - Intronic
1016519575 6:144931464-144931486 AGGCAGGTCAATGCAAATTGAGG + Intergenic
1017035209 6:150261093-150261115 GGACAGGTGGAGGCAGATTCAGG - Intergenic
1018623260 6:165751802-165751824 GGACAGGTGCATGCAAATTGAGG - Intronic
1021871546 7:25011853-25011875 TTACAAGTGCCTGCAAATTGGGG + Intergenic
1023341137 7:39221210-39221232 TAACAGGTACATGTAAATTGTGG + Intronic
1027350734 7:77308793-77308815 GGGCAGATGCATGCACATGGTGG + Intronic
1027548246 7:79557599-79557621 TGACAGGGGCATGCAATATGTGG + Intergenic
1028836356 7:95379207-95379229 GGACAGATGCATGTATATTTAGG - Intronic
1030776765 7:113543307-113543329 GGACGAGTCAATGCAAATTGAGG - Intergenic
1035070227 7:156139176-156139198 GGACAGGTGCATGAAGATGATGG - Intergenic
1036484699 8:9169066-9169088 AGACACGTGCATGGAAATGGTGG - Intergenic
1038374693 8:27027725-27027747 GGACAGGTGGATGCAAAAAAAGG - Intergenic
1038916707 8:32032094-32032116 TGACAGGTGCTGGCAAGTTGGGG - Intronic
1045159140 8:99517275-99517297 TGACAGTTGCATGAAAATTCTGG + Intronic
1048179562 8:132182562-132182584 GGACAGGTGCATCCCCCTTGGGG - Intronic
1048798145 8:138170784-138170806 GGAGACTGGCATGCAAATTGTGG + Intronic
1050875339 9:10627623-10627645 GGACAAGTACAAGCAAACTGTGG + Intergenic
1051576777 9:18624954-18624976 GGTGAGGTGCATGCATATGGTGG - Intronic
1052195079 9:25702312-25702334 GGAGAGGGGAATGTAAATTGTGG - Intergenic
1052403231 9:28026947-28026969 GAAGAGTTGCATGCAAATTTAGG - Intronic
1053492530 9:38520282-38520304 GAACAGGTATATGCATATTGGGG + Intergenic
1055079494 9:72255226-72255248 GGGTGGGTGGATGCAAATTGAGG + Intronic
1186288311 X:8069378-8069400 GGACAGGAGGATGCAGAATGAGG - Intergenic
1186396276 X:9212128-9212150 GGACAGGTGGTTGGAATTTGGGG - Intergenic
1188880592 X:35486943-35486965 CTACAGGTGGATGCATATTGTGG + Intergenic
1189047562 X:37609825-37609847 AGATAGGGGCATGCAGATTGAGG + Intronic
1190554767 X:51623081-51623103 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1190953319 X:55167455-55167477 GGGCAGGTTAATGCAAGTTGAGG - Intronic
1191581232 X:62763721-62763743 GGACATTTGCAAGCCAATTGAGG - Intergenic
1191583462 X:62791971-62791993 GGACATTTGCATGCCCATTGAGG - Intergenic
1191882614 X:65857655-65857677 GGACTGGTCAATGCAAAGTGTGG + Intergenic
1195389221 X:104343689-104343711 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1196286601 X:113888851-113888873 GGACAGCTGCATTGAAATGGGGG - Intergenic
1198170426 X:134099945-134099967 GGTCAGGTGCATGCCCATGGTGG - Intergenic