ID: 1018624489

View in Genome Browser
Species Human (GRCh38)
Location 6:165764680-165764702
Sequence AGCTTCACTCCTGAGCCGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 4, 3: 7, 4: 74}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018624489_1018624496 13 Left 1018624489 6:165764680-165764702 CCCACCGGCTCAGGAGTGAAGCT 0: 1
1: 0
2: 4
3: 7
4: 74
Right 1018624496 6:165764716-165764738 GTGAGTGTTACAGCTCATAAAGG 0: 964
1: 1387
2: 1758
3: 1200
4: 539
1018624489_1018624497 21 Left 1018624489 6:165764680-165764702 CCCACCGGCTCAGGAGTGAAGCT 0: 1
1: 0
2: 4
3: 7
4: 74
Right 1018624497 6:165764724-165764746 TACAGCTCATAAAGGCACTGTGG No data
1018624489_1018624492 -9 Left 1018624489 6:165764680-165764702 CCCACCGGCTCAGGAGTGAAGCT 0: 1
1: 0
2: 4
3: 7
4: 74
Right 1018624492 6:165764694-165764716 AGTGAAGCTGCAGACCTTCCCGG 0: 85
1: 1291
2: 1381
3: 1382
4: 1496

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018624489 Original CRISPR AGCTTCACTCCTGAGCCGGT GGG (reversed) Intronic
902654442 1:17857881-17857903 ACCATCACTCCTGAGCAGCTTGG - Intergenic
905914926 1:41678212-41678234 TGCTGCACTCCTGGGCCGCTGGG + Intronic
911951961 1:104184720-104184742 ATCCTCACTCCTCAGCCTGTGGG + Intergenic
913077833 1:115356278-115356300 GGCTTCACCCCTGAGCCTGTGGG - Intergenic
922887897 1:229034193-229034215 AGCTTTTCTCCTGAGCTGCTGGG - Intergenic
1063376318 10:5556683-5556705 AGCTTCACTCCTGAGCCCCTGGG - Intergenic
1076693335 10:132234867-132234889 AGCTTCCCACCTGCCCCGGTGGG - Intronic
1087977176 11:104564860-104564882 AGCTGGACTCCTGAGTCGGGTGG - Intergenic
1091582114 12:1796522-1796544 CGCTTCACTCCGGAGCCCGCTGG + Intronic
1092927675 12:13287021-13287043 AGCTTCACTCCTGGGAGAGTGGG + Intergenic
1093583099 12:20806707-20806729 AGCTTCACTCTTGAGCCAACGGG - Intergenic
1103760787 12:123249229-123249251 AGCTGGACTCCTGAGTCGGGTGG - Intronic
1104749675 12:131230248-131230270 AGCAGCTCTCCTGAGCCGGGAGG + Intergenic
1104822237 12:131683823-131683845 AGCTTCTCTCCTGCACCGATGGG + Intergenic
1110064615 13:71087696-71087718 AGCTGGACTCCTGAGTCGGGTGG + Intergenic
1113120399 13:106918147-106918169 AACTTCATTCCTCAGCCGGTGGG + Intergenic
1113335938 13:109375959-109375981 AGCTTCCCTCCTGAGTAGCTAGG + Intergenic
1115284344 14:31701002-31701024 AGCTGGGCTCCTGAGCCGGCTGG + Intronic
1115510088 14:34130278-34130300 AGCTTCACTACTGAGTGGGAAGG - Intronic
1119230405 14:72974894-72974916 AGCATCACTGCCGAGCCTGTGGG - Exonic
1124631977 15:31343217-31343239 TGCTGCACACCTGAGCCGGCGGG - Intronic
1127372617 15:58355301-58355323 GGCTTCACTCTTGAACAGGTAGG - Intronic
1127892288 15:63264540-63264562 AGGTTCACTCCTTAGCTGGCTGG + Exonic
1128242357 15:66109646-66109668 AGCTTCAGACCTCAGCCGGCCGG - Intronic
1133288273 16:4701452-4701474 AGCTTCGCTGCTGAGCCCCTGGG + Exonic
1138889785 16:61128668-61128690 AGCTGGGCTCCTGAGGCGGTTGG - Intergenic
1152652152 17:81499699-81499721 AGCTTCTCTCCTGGGGCGGAGGG - Intergenic
1153582042 18:6582931-6582953 AGGTCCACTCCTGAGCCTTTAGG - Intronic
1158500640 18:57997685-57997707 AGCTGTACCCCTGAGCTGGTCGG + Intergenic
1162007470 19:7789393-7789415 GGCTCCACCCCTGAGCCCGTGGG + Intergenic
925996589 2:9298563-9298585 GGCTCCACTGCTGAGCAGGTGGG - Intronic
929847200 2:45542143-45542165 AGCCTCACTCCTGTGTTGGTTGG + Intronic
930593474 2:53356883-53356905 AGCTTGGCTCCTGAGTCGGGTGG + Intergenic
934935284 2:98460789-98460811 AGCTTCACCCCTGACCCCATGGG - Intronic
937789380 2:125942925-125942947 AGCTGCACTCCTCAGCCATTGGG + Intergenic
945575316 2:211523655-211523677 AGCTTCACTCCTGAAGCCGGCGG - Intronic
948498387 2:238370631-238370653 ATCTTCCCTCCTGAGCCATTTGG - Intronic
1171413630 20:24962779-24962801 AGCTTCCCTCCTGAGCTAGTCGG + Intergenic
1171462679 20:25307656-25307678 AGCTCCACTCCTGAACAGGAAGG + Intronic
1175769976 20:61617436-61617458 GGCTTCACTCCCCAGCCTGTGGG - Intronic
1180557815 22:16591940-16591962 AGCTTCAAGCCTGAGCGTGTTGG - Exonic
1181267794 22:21641353-21641375 AGCTTCACTCCAGATCCTGTGGG - Intergenic
1184194058 22:42914765-42914787 AGCTTGACACCTGAGCCACTTGG + Intronic
949942910 3:9168383-9168405 AGCTCCAGTCCTGAGCGGGGTGG - Intronic
950154277 3:10709951-10709973 AGCTTCAACTCTGAGCCCGTTGG + Intergenic
952400568 3:32959596-32959618 TGCTTCAGTCCTGAACTGGTGGG - Intergenic
963397396 3:144751030-144751052 GGCTTCATTCCTGAGCCAGCGGG + Intergenic
963673362 3:148279931-148279953 ACCTTCACTCCTGAGCCAGCGGG - Intergenic
963702124 3:148639399-148639421 AGCTTCACTCTTTAGCTGGATGG - Intergenic
970462392 4:16288078-16288100 AGCTTCACCTCTCAGCCTGTGGG + Intergenic
985571123 5:645874-645896 AGCGTCACTCCTGCTCCCGTCGG + Intronic
985571132 5:645939-645961 AGCGTCACTCCTGCTCCCGTTGG + Intronic
991107664 5:62862249-62862271 AGCTTCCCTCCTGTGCCCCTTGG + Intergenic
995568852 5:113458369-113458391 AGCTTCACTCCTGAGCCAGCGGG + Intronic
998117603 5:139549709-139549731 AGCTGCACTCCTCAGCCCTTGGG - Intronic
999282178 5:150373161-150373183 AGCCTCACTCCTGAGTAGCTAGG + Intronic
1002177511 5:177409612-177409634 AGCTGCCCTCCTGAGCCTGGTGG + Intronic
1003532930 6:6952698-6952720 GCCTGCACTCCTGAGCCGCTGGG - Intergenic
1004906349 6:20239920-20239942 AGCTTCACTCCTGAGCTAGTGGG + Intergenic
1004912787 6:20302372-20302394 AGCTTCACTCTTGAGCCAGCGGG + Intergenic
1005596044 6:27380326-27380348 AGCTTCACTCCTGAGCCGCCAGG - Intronic
1005894217 6:30164058-30164080 AGCTACACTTCTTACCCGGTAGG - Exonic
1011470323 6:87701789-87701811 CGCTTGGCTCCTGAGCCCGTCGG - Exonic
1018476225 6:164144827-164144849 AGCTGCCCTCCTGAGCGGGCTGG - Intergenic
1018594964 6:165469374-165469396 AGCGTCACTCCTAAGCATGTTGG - Intronic
1018624489 6:165764680-165764702 AGCTTCACTCCTGAGCCGGTGGG - Intronic
1020625495 7:10573686-10573708 AGCCTCAATCCTGAGCCTGTGGG + Intergenic
1022235364 7:28455627-28455649 GTATTCACTCCTGAGCCGGAAGG - Intronic
1023492185 7:40755192-40755214 ACCTTCACTCCTCAGACAGTAGG - Intronic
1024274991 7:47670280-47670302 AGCTTCTCCCCTGAGGCTGTGGG + Intergenic
1024982618 7:55170406-55170428 AGCATGACTCCTGAGCAGCTGGG - Intronic
1031213195 7:118857935-118857957 AGCTTCACTCCTGAGGCCAGTGG - Intergenic
1034619500 7:152446065-152446087 AGCTTCAAGCCTGAGCGTGTTGG + Intergenic
1035243891 7:157550140-157550162 AGCTTCTCTCCTGATTCGCTGGG - Intronic
1035624200 8:1059384-1059406 AGCCGCACTCCTGAGCCCGAAGG + Intergenic
1048339168 8:133525662-133525684 GGCTTCCCTCCTGTGCCTGTCGG + Intronic
1049433268 8:142575005-142575027 AGCTGCGCACCTGAGCCGGGAGG - Intergenic
1052991543 9:34521841-34521863 ACCTGCAGTCCTGAGCCTGTTGG + Exonic
1053811863 9:41861433-41861455 AGCTTCAGTCCTGAGCCCAGTGG - Intergenic
1054618732 9:67326006-67326028 AGCTTCAGTCCTGAGCCCAGTGG + Intergenic
1057741254 9:97713690-97713712 AATTGCACTCCTGAGCAGGTAGG - Intergenic
1061267307 9:129514310-129514332 AGCTTCCCTCCTGTGCTCGTTGG - Intergenic
1186207722 X:7217468-7217490 ACCTTCCCTCCTGAGCATGTCGG + Intergenic
1195127339 X:101821817-101821839 AGGTTCACTCCAGACCCTGTTGG + Intergenic
1197526845 X:127575048-127575070 AGCCTCCCTCCTGAGCTCGTGGG - Intergenic
1197917176 X:131548642-131548664 AGCTTCACTACTCAGCCATTGGG - Intergenic