ID: 1018628345

View in Genome Browser
Species Human (GRCh38)
Location 6:165801897-165801919
Sequence ATCCACCTTTGGCATATAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 98}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018628345_1018628351 2 Left 1018628345 6:165801897-165801919 CCCATTATATGCCAAAGGTGGAT 0: 1
1: 0
2: 1
3: 11
4: 98
Right 1018628351 6:165801922-165801944 TCAGGGACCAGCAATGGAGATGG 0: 1
1: 1
2: 2
3: 24
4: 294
1018628345_1018628352 3 Left 1018628345 6:165801897-165801919 CCCATTATATGCCAAAGGTGGAT 0: 1
1: 0
2: 1
3: 11
4: 98
Right 1018628352 6:165801923-165801945 CAGGGACCAGCAATGGAGATGGG No data
1018628345_1018628350 -4 Left 1018628345 6:165801897-165801919 CCCATTATATGCCAAAGGTGGAT 0: 1
1: 0
2: 1
3: 11
4: 98
Right 1018628350 6:165801916-165801938 GGATGCTCAGGGACCAGCAATGG 0: 1
1: 0
2: 4
3: 17
4: 236
1018628345_1018628354 18 Left 1018628345 6:165801897-165801919 CCCATTATATGCCAAAGGTGGAT 0: 1
1: 0
2: 1
3: 11
4: 98
Right 1018628354 6:165801938-165801960 GAGATGGGCACACAGACAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018628345 Original CRISPR ATCCACCTTTGGCATATAAT GGG (reversed) Intronic
900699034 1:4032637-4032659 GTCCACCTCTGGCATATCCTGGG + Intergenic
906277993 1:44532420-44532442 GTCCACCTCTGGTATATAGTGGG - Intronic
911700692 1:100949162-100949184 ATCTACCTTTGGTCTATGATGGG + Intronic
912538315 1:110392925-110392947 ATTCATCTTTGTCTTATAATAGG + Intergenic
916446042 1:164872675-164872697 ACACACCATTGGCCTATAATGGG + Intronic
917631143 1:176892709-176892731 TTCTACCTCTGGCATATCATTGG - Intronic
919142882 1:193595367-193595389 CACCATATTTGGCATATAATAGG - Intergenic
919704523 1:200663700-200663722 AACAGCCTTTGGCATATAATGGG + Intronic
1068724578 10:60287118-60287140 ATCCACCTTGGGCATGTCCTAGG + Intronic
1070012592 10:72491042-72491064 ATCCTCCTTTGGCCTTTTATGGG - Intronic
1070547764 10:77465956-77465978 ATCCACCCTTGGCAGAAAATGGG + Intronic
1070693486 10:78544517-78544539 CTCCTCCTTCGGCATATAATCGG + Intergenic
1074422837 10:113324503-113324525 ATCCAAATTTGGTATATCATGGG + Intergenic
1076415583 10:130285511-130285533 TTCCAATTTTGACATATAATAGG - Intergenic
1079646817 11:22874013-22874035 ATCCATATTTGTCATATAATAGG - Intergenic
1083729467 11:64644972-64644994 ATCCAGCTCTGGCATGTAGTAGG - Intronic
1098217204 12:68233378-68233400 TGCCTCCTTTGGCCTATAATAGG - Intergenic
1098558411 12:71845296-71845318 ATGCACCTTAGGCAGATTATTGG + Intronic
1100128000 12:91453621-91453643 TTCAACATTTGGCACATAATAGG + Intergenic
1104188664 12:126457108-126457130 TTCCACATTTAGCATATAAGAGG - Intergenic
1106184940 13:27401060-27401082 ATCCACATTTGGCCAATAAAAGG + Intergenic
1108219716 13:48220920-48220942 AGCCACTTTTGGTATCTAATAGG + Intergenic
1109240204 13:59877246-59877268 ATCTACCTTAGGCAACTAATGGG - Intronic
1111030148 13:82586471-82586493 ATCCACTGTCGACATATAATTGG - Intergenic
1111225061 13:85259862-85259884 CTAGATCTTTGGCATATAATAGG + Intergenic
1111668775 13:91302483-91302505 TTCCATCTTTGGCTTATAATTGG - Intergenic
1114288366 14:21267237-21267259 ATCCTCCTTAGGCAAATAAGGGG - Intronic
1115676950 14:35686761-35686783 ATGCATGTTTGGCAAATAATTGG - Intronic
1115725675 14:36213812-36213834 ATACACCCTTGGCATATGGTGGG - Intergenic
1120804593 14:88733210-88733232 ATCCTCCTTTGGCAAATGCTGGG + Intronic
1123005378 14:105319273-105319295 AGCCACATTTGGTTTATAATTGG + Intronic
1127432642 15:58925693-58925715 ATATACCTTTGGCATATTCTAGG - Intronic
1135753245 16:25073855-25073877 ATCCACCTTTGGCCAAAAAAAGG - Intergenic
1136100388 16:27991009-27991031 CTCCACCTTATGCAAATAATCGG + Intronic
1137422116 16:48343920-48343942 ATTCTACTTTGGCATATAGTGGG + Intronic
1151724613 17:75876956-75876978 AGGCACCTCTGGCATATTATGGG - Intronic
1153153675 18:2124987-2125009 ACCCACCTTTGTCTTTTAATTGG + Intergenic
1153969395 18:10211839-10211861 ACCCTCCTTTTGCCTATAATAGG + Intergenic
1155564756 18:27121546-27121568 ATCCAATTTTGGTAAATAATTGG + Intronic
1156155060 18:34291706-34291728 GTCCACATTTGGGATATATTTGG + Intergenic
1156170814 18:34482926-34482948 AACAACTTTTGGCATATATTTGG - Intergenic
1156647644 18:39185533-39185555 ATCAACCTTTGTTAAATAATTGG - Intergenic
1156853995 18:41760837-41760859 TTCCAGCTTTAGCATATGATTGG - Intergenic
1157913102 18:51637930-51637952 ATCCAAGGTTGGCATATAAAGGG + Intergenic
1167697815 19:51025402-51025424 CTCCTCCTTTGGCATTTAAAGGG + Intronic
926918699 2:17917907-17917929 ATCCTCCTTTGATAAATAATGGG - Intronic
935680716 2:105634713-105634735 ATCCACCTTCTGAATATCATCGG + Intergenic
935751988 2:106243663-106243685 ATCCACATGTTGCACATAATAGG + Intergenic
935912398 2:107911210-107911232 ATCCACATGTTGCACATAATAGG + Intergenic
943537662 2:189172505-189172527 ATGCACCTTTGTCATCTGATGGG - Intronic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
948335033 2:237201050-237201072 AACGACATCTGGCATATAATAGG + Intergenic
1169826175 20:9771291-9771313 AACCATTTTTGACATATAATAGG - Intronic
1172068738 20:32240510-32240532 ATCCACCTTTGCAAAAAAATTGG + Intergenic
1172177571 20:32981619-32981641 CTCCAGCTTTGGAATATATTTGG - Intergenic
1177487041 21:21772447-21772469 ATCTACTCTTGGCATACAATCGG + Intergenic
1178873869 21:36397516-36397538 ATTCAGCTTTGGCATTTACTTGG + Intronic
1182034152 22:27184279-27184301 GTCCAACACTGGCATATAATAGG + Intergenic
952649409 3:35707236-35707258 CTCCCCCTTTGGCATTCAATGGG + Intronic
952872275 3:37911591-37911613 ATGAACCTTTGGCAAATAACAGG + Intronic
955283985 3:57621119-57621141 ATACACCATTGGCACAGAATAGG + Intergenic
957414946 3:79889877-79889899 ATTGACCTTGGGTATATAATGGG - Intergenic
964872938 3:161333421-161333443 CTCAAGCTTTGTCATATAATTGG + Intergenic
965739098 3:171853972-171853994 ATCCAGGTCTGGCACATAATAGG + Intronic
965739190 3:171855514-171855536 ATCCAGGTCTGGCACATAATAGG - Intronic
967095083 3:186171238-186171260 ACCAGCCTTTGGCATATAAAAGG + Intronic
971852724 4:32004235-32004257 TTTCACCTTTGCTATATAATAGG + Intergenic
976460575 4:85307084-85307106 CTACACCTTTGGAATATATTTGG + Intergenic
977244681 4:94617453-94617475 ACCAACGTTTGGCATATAGTAGG + Intronic
979452130 4:120885190-120885212 ACCCACCTCTGGCATATTAGAGG + Intronic
980234442 4:130087206-130087228 AACCACGTTAGGCATATAATTGG - Intergenic
981162496 4:141515274-141515296 ATATTCCTTTGGGATATAATGGG + Intergenic
981886691 4:149683413-149683435 ATTCACATTTGGCACATAGTAGG + Intergenic
983794495 4:171844142-171844164 TTCCACCTTTAGAATTTAATAGG - Intronic
984377857 4:178954756-178954778 ATCTACTTTTGGCATGTTATTGG - Intergenic
985860178 5:2464551-2464573 ATCCACATTTCGTATGTAATTGG - Intergenic
993979166 5:94522980-94523002 ATCCACCTTCAGGAGATAATGGG + Intronic
994950380 5:106454034-106454056 ATCCATCTATGGCACATAATAGG + Intergenic
999223055 5:149997627-149997649 ACCCACCTTTGTCATATACTTGG - Intronic
1002366271 5:178714619-178714641 ATACAACTTTTGTATATAATTGG - Intronic
1009196899 6:60697203-60697225 ATCCACACATGGCATACAATAGG + Intergenic
1012433119 6:99186840-99186862 TTCCACCTTTGCCATGTATTGGG - Intergenic
1012688357 6:102281388-102281410 ATCCATCTGTGTCTTATAATTGG + Intergenic
1013488150 6:110617995-110618017 ATCCATATTTGGCATAAAAATGG + Intronic
1014572152 6:123022971-123022993 CTCCACATTTAGCATTTAATAGG - Intronic
1015872497 6:137791198-137791220 ATGCAACTTTGGAATATCATGGG - Intergenic
1016491232 6:144605336-144605358 ATCCAGCATTGGCATATAATAGG + Intronic
1018628345 6:165801897-165801919 ATCCACCTTTGGCATATAATGGG - Intronic
1021108781 7:16670553-16670575 TTCCACCTTTCTCATATTATAGG + Intronic
1022265535 7:28750314-28750336 ATCATCCTTTGGCATTTAAAAGG + Intronic
1024504060 7:50146371-50146393 TTCTGCCTTTGGCAAATAATGGG + Intronic
1026255017 7:68703497-68703519 CTCCACCTTTAGCATATATGTGG - Intergenic
1028701431 7:93785363-93785385 ATCCCGCTTTGGCATATGAGAGG + Intronic
1034662176 7:152781024-152781046 ATACACATTTGGCAAATAGTGGG + Intronic
1036630046 8:10506271-10506293 ATCCTCCTCTGGCTAATAATAGG - Intergenic
1037188954 8:16099186-16099208 ACCCAGGTTTGGCAGATAATGGG + Intergenic
1039222018 8:35342454-35342476 ATCCACCATCGGCAGATAATGGG + Intronic
1043666380 8:82820478-82820500 ATCCACTTTTGGCCTACAGTGGG + Intergenic
1044081136 8:87885556-87885578 ATCCACCTTTGCCATCAAACTGG - Intergenic
1045023792 8:98066969-98066991 AACAACGCTTGGCATATAATAGG + Intronic
1046821161 8:118635887-118635909 ATCCACTATTGGGCTATAATAGG + Intergenic
1047330358 8:123881363-123881385 ATTCACCTATGGCAAATAATGGG + Intronic
1049974038 9:845053-845075 TTTCACCTTTGGCTTATATTTGG + Intronic
1052569561 9:30201926-30201948 TTTCACATTTGCCATATAATAGG - Intergenic
1059685161 9:116628100-116628122 ACCCACCTTTAGCAGATATTGGG + Intronic
1061092413 9:128434085-128434107 AACCACCTGTGGCATACAATGGG - Exonic
1061390647 9:130315418-130315440 CTCCAAGCTTGGCATATAATTGG - Intronic
1186167670 X:6844161-6844183 ATCCACCTTTCCCATATATAAGG + Intergenic
1194842289 X:98757862-98757884 AGCCACCTTTGTAATATAAATGG + Intergenic
1197975940 X:132166048-132166070 AGCCACCTTGGAAATATAATAGG - Intergenic
1198115369 X:133539748-133539770 AGGCACCTGTGGCTTATAATTGG + Intronic