ID: 1018629464

View in Genome Browser
Species Human (GRCh38)
Location 6:165809746-165809768
Sequence CCCACTAGGAGGGCTGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 280}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018629464_1018629474 -5 Left 1018629464 6:165809746-165809768 CCCTTCCCAGCCCTCCTAGTGGG 0: 1
1: 0
2: 1
3: 19
4: 280
Right 1018629474 6:165809764-165809786 GTGGGTGAAAGGCACATGGAAGG 0: 1
1: 0
2: 2
3: 42
4: 317
1018629464_1018629476 20 Left 1018629464 6:165809746-165809768 CCCTTCCCAGCCCTCCTAGTGGG 0: 1
1: 0
2: 1
3: 19
4: 280
Right 1018629476 6:165809789-165809811 TATTAGCATCAGCCCTGGAACGG No data
1018629464_1018629477 21 Left 1018629464 6:165809746-165809768 CCCTTCCCAGCCCTCCTAGTGGG 0: 1
1: 0
2: 1
3: 19
4: 280
Right 1018629477 6:165809790-165809812 ATTAGCATCAGCCCTGGAACGGG 0: 1
1: 0
2: 1
3: 6
4: 125
1018629464_1018629478 24 Left 1018629464 6:165809746-165809768 CCCTTCCCAGCCCTCCTAGTGGG 0: 1
1: 0
2: 1
3: 19
4: 280
Right 1018629478 6:165809793-165809815 AGCATCAGCCCTGGAACGGGCGG No data
1018629464_1018629475 15 Left 1018629464 6:165809746-165809768 CCCTTCCCAGCCCTCCTAGTGGG 0: 1
1: 0
2: 1
3: 19
4: 280
Right 1018629475 6:165809784-165809806 AGGCATATTAGCATCAGCCCTGG 0: 1
1: 0
2: 0
3: 8
4: 136
1018629464_1018629473 -9 Left 1018629464 6:165809746-165809768 CCCTTCCCAGCCCTCCTAGTGGG 0: 1
1: 0
2: 1
3: 19
4: 280
Right 1018629473 6:165809760-165809782 CCTAGTGGGTGAAAGGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018629464 Original CRISPR CCCACTAGGAGGGCTGGGAA GGG (reversed) Intronic
900095511 1:938510-938532 CCAAGTAGGAGGCCTGGGAGTGG + Intronic
900577271 1:3389527-3389549 GCCATGAGGAGGGCTGGGATGGG - Intronic
900644335 1:3702266-3702288 CCCTCCAGGAGGGCTGTGGAGGG - Intronic
901388919 1:8929938-8929960 GCCACAAGAGGGGCTGGGAAGGG + Intergenic
902451318 1:16498771-16498793 CACACTAGGAGGGCAGTGCAGGG + Intergenic
902948203 1:19859292-19859314 CCATCTAGTAGGGCTGGGCACGG + Intergenic
903326872 1:22573862-22573884 ACACCCAGGAGGGCTGGGAAGGG + Intronic
905266221 1:36756011-36756033 CCCAGGAGAAGGGCTGGGAGGGG + Intergenic
905916525 1:41688451-41688473 CCCAGAAAGAGGGCTGGGGAGGG - Intronic
907320783 1:53600894-53600916 CCCACTAGCAGGGCGAGGCAGGG - Intronic
907567852 1:55453117-55453139 CCTACTATGAGTGCTGAGAAGGG + Intergenic
909814531 1:79975343-79975365 CACAGTAGGAGGGATGGGAGAGG + Intergenic
913365787 1:118036944-118036966 CTCAGTGGGAAGGCTGGGAATGG + Intronic
915290703 1:154881260-154881282 CCCACCAGGAGGGCTAGAGAAGG + Intergenic
915849560 1:159306667-159306689 CAGCTTAGGAGGGCTGGGAAAGG + Intronic
917931957 1:179828794-179828816 TCCACTGGCTGGGCTGGGAATGG - Intergenic
1063373013 10:5533842-5533864 CTCATTAGGAAGCCTGGGAATGG + Intergenic
1064635627 10:17363537-17363559 CCAACAAAGAGGGCTGAGAAAGG - Intronic
1066095023 10:32064149-32064171 CCTACTTGGAGGGCTGAGATGGG + Intergenic
1067093955 10:43286213-43286235 CCCTCAAGGAGGGCTGGCGAGGG - Intergenic
1069779061 10:70943456-70943478 TCCAATAGGAGCACTGGGAATGG + Intergenic
1070350153 10:75583974-75583996 CCCTATGGGGGGGCTGGGAAGGG - Intronic
1070954168 10:80453978-80454000 CCCACTGGGAGGGCGCGGACCGG + Intergenic
1072268041 10:93749265-93749287 CCCAGTAGGAGTGCTGGCAGGGG + Intergenic
1073341903 10:102751419-102751441 GCTACTAGGAGGGCTGAGATAGG - Intronic
1073971836 10:109052693-109052715 GCCACTAAGTGGGATGGGAATGG - Intergenic
1074108511 10:110406291-110406313 GCCACGAAGAGGGCTGGTAAGGG - Intergenic
1074143670 10:110698323-110698345 CACAGGAGGTGGGCTGGGAAGGG + Intronic
1074377068 10:112949859-112949881 CCCACTTGGGGGGCGGGGATGGG - Intergenic
1074437090 10:113443481-113443503 CCCAATAGGAGAGCTAGGAGGGG - Intergenic
1074973747 10:118564725-118564747 CCCATTAGGAGAGTTGGGGAGGG - Intergenic
1076326771 10:129629848-129629870 CTCACTAGGAGGGATGGGTTGGG - Intronic
1076625249 10:131817949-131817971 CCCTCGGGGAGGGGTGGGAAGGG - Intergenic
1076822246 10:132945304-132945326 CCCACTAGGGGAGCTGGAGAAGG + Intergenic
1078527514 11:12111503-12111525 CTCACTGGCAGAGCTGGGAACGG + Intronic
1078552508 11:12290253-12290275 CCCCCTAGCAGGGGTGGGAGTGG + Intronic
1080557275 11:33429260-33429282 ACCACAATGAGGGCTGGGAACGG - Intergenic
1081702682 11:45161923-45161945 ACCACCGGCAGGGCTGGGAATGG + Intronic
1081821553 11:46001280-46001302 ACCACCAGGGGGGCTGGAAATGG + Intronic
1083679232 11:64343625-64343647 CCCACTGGAAGGGCTGGGGTGGG + Intronic
1083804676 11:65066739-65066761 CCCTCTAGGAGAGCTGGGCTGGG + Intronic
1084582036 11:70030041-70030063 GCCACCAGGAGGGGTGGGGAGGG + Intergenic
1086143173 11:83521636-83521658 CCCACTAGGAGGACAGTGGAAGG - Intronic
1089392707 11:118113017-118113039 ACCTCAAGGAGGGCTGGGGAAGG - Intronic
1089631496 11:119787272-119787294 CCTCCCAGGAGGGCTGGGAGCGG - Intergenic
1091045045 11:132317885-132317907 TCCCCCAGGAGGGCTGGGAAGGG + Intronic
1091205775 11:133820012-133820034 CCAACTAGGCAGCCTGGGAAAGG - Intergenic
1093545760 12:20345355-20345377 TCTACTAGGGGGGCTGGGCACGG - Intergenic
1094489414 12:30949686-30949708 GCAGCTAGGAGGCCTGGGAAAGG - Intronic
1097288559 12:57895931-57895953 CCCACTGGGAGTCCTGGGATGGG + Intergenic
1098346293 12:69507494-69507516 CCCATTAGTACTGCTGGGAAAGG + Intronic
1101963238 12:109265379-109265401 CCCACAAGTAGGCCTGGGGAGGG - Exonic
1102232662 12:111274371-111274393 GCCACTGGGAGGGCTGAGTAAGG + Intronic
1102548716 12:113675273-113675295 CCCCATCGGAGTGCTGGGAAGGG + Intergenic
1104762230 12:131304368-131304390 GCCACAAGGAGGGCTGGGGAAGG + Intergenic
1104817546 12:131656428-131656450 GCCACAAGGAGGGCTGGGGAAGG - Intergenic
1104931306 12:132340801-132340823 CCCAGTGAGAGGGCTGGAAATGG - Intergenic
1106162557 13:27214180-27214202 ACCACAAGGAGGACTGAGAAAGG - Intergenic
1106183144 13:27385415-27385437 CCTACATGCAGGGCTGGGAAAGG - Intergenic
1106402100 13:29441112-29441134 CACACTAGCAAGTCTGGGAAGGG - Intronic
1110601375 13:77378156-77378178 GCCAATAGGAGGCATGGGAAAGG + Intergenic
1113004123 13:105679325-105679347 CACATTTGGAGGGGTGGGAATGG + Intergenic
1113778810 13:112963980-112964002 CCCACTGGAAGGGCTGTGGATGG + Intronic
1113813865 13:113158637-113158659 CCCACCCGGAGCGCTGGGACAGG - Exonic
1114476009 14:22995387-22995409 AACACTAGGAAGGCTGGGCATGG + Intronic
1117733924 14:58750913-58750935 CCCTCTTGGGGGCCTGGGAAAGG + Intergenic
1118166325 14:63339866-63339888 CCTACTAGGAAGGCTGTGATGGG + Intergenic
1119717254 14:76867709-76867731 CCCAGGAGGAGGGCAGGCAAGGG + Intronic
1121009719 14:90512771-90512793 CCCACACTGAGGGCTTGGAAGGG - Intergenic
1121554261 14:94824444-94824466 CCAGCTAGAATGGCTGGGAAAGG + Intergenic
1124384454 15:29194999-29195021 CCTCCCAGGAGGGCTGTGAAAGG + Intronic
1125532141 15:40420609-40420631 CTCACTGGGAGATCTGGGAAAGG - Intronic
1129386703 15:75200464-75200486 CCCACTAGCAGGGCAGGGACAGG + Intronic
1129465453 15:75722077-75722099 CACATGAGGAGGTCTGGGAACGG + Intergenic
1129705459 15:77791662-77791684 CCCACTAGTAGGGCTCAGAAGGG + Intronic
1129760431 15:78126087-78126109 CAGCCCAGGAGGGCTGGGAATGG + Intronic
1130645952 15:85727270-85727292 GACATCAGGAGGGCTGGGAAGGG - Intronic
1131034834 15:89215285-89215307 CCCACTAGGAGGGATGGGGTAGG - Intronic
1131084713 15:89566631-89566653 CACACTAGGAAGGCTGAGGAAGG - Intergenic
1131872939 15:96779620-96779642 CCCGGCAGGTGGGCTGGGAAAGG - Intergenic
1132555093 16:568829-568851 CCGATTAGGAGGCCTGGGCAGGG - Exonic
1132603829 16:785487-785509 CCCTCTAGAGGGGCTGGGAAGGG - Exonic
1132845706 16:1999936-1999958 CCCACCAGGAAGGCTGGGAAGGG - Exonic
1132860499 16:2069136-2069158 CCCACTAGGCAGGCAGGAAAAGG - Intronic
1133025485 16:2987374-2987396 CCCACCAGGCTGGCTGGGGACGG - Intergenic
1133026552 16:2991230-2991252 CCCACTCCCAGGCCTGGGAAGGG - Intergenic
1133135857 16:3711308-3711330 GCCAATGGCAGGGCTGGGAACGG + Intronic
1134762375 16:16725770-16725792 GCTACTAGGAGGGCTGAGACAGG - Intergenic
1134983684 16:18633400-18633422 GCTACTAGGAGGGCTGAGACAGG + Intergenic
1136005591 16:27326821-27326843 CCCACTGGCTGGGCTGGGGACGG + Intronic
1136222518 16:28837146-28837168 CCCACGAGGATGGCTGGACAAGG + Exonic
1136237675 16:28924851-28924873 GCCACTAGGAGGGCGGGGCCAGG - Intronic
1136370653 16:29834022-29834044 CCCGCAAGGAGTGCTGGGACCGG + Exonic
1138564778 16:57825091-57825113 CCTGCTAGGAGGGCTGGGCTGGG - Intronic
1139917417 16:70437326-70437348 CCAAGGGGGAGGGCTGGGAAGGG + Intronic
1139960156 16:70712882-70712904 CCCACGGGCAGGGCTGGGGAAGG + Intronic
1141576064 16:84964185-84964207 CCCATGAGGAGGGGTGGGAGAGG - Intergenic
1141693740 16:85610614-85610636 GCCACCAGGCGGGCTGGCAAGGG - Intergenic
1142030622 16:87836682-87836704 CCCACGAGCAGGGCTGTGGACGG + Intronic
1142470436 17:160553-160575 CCCCCTAAGAGGACTGGGCAAGG - Intronic
1142752563 17:1997813-1997835 CCGAGTAGGAGGGCTGTGAAGGG - Intronic
1143373429 17:6454319-6454341 CTCTCTGGGTGGGCTGGGAAGGG - Exonic
1143626290 17:8111989-8112011 CTCCCTGGGAGGGCTGGGAGAGG + Intronic
1144496512 17:15749508-15749530 CCCACCAGGAGTCCTGGGCAGGG - Intergenic
1146180278 17:30693768-30693790 CCCTCCAGGAGGGATGGGTAGGG + Intergenic
1148549886 17:48544025-48544047 TCCACTGGGAGGGCTTGGGAGGG - Intronic
1148804624 17:50257934-50257956 CGAAGTAAGAGGGCTGGGAAGGG - Intergenic
1149602844 17:57904361-57904383 GCCACCAGGAGTGGTGGGAAAGG + Intronic
1150979816 17:70128416-70128438 CCCACGAGGAGGTCTGAGAGAGG - Intronic
1151318116 17:73336435-73336457 CCAATAAGGAGGCCTGGGAAGGG - Exonic
1152392261 17:80009940-80009962 CCCACTGAGAGGACTGTGAAGGG - Intronic
1152523358 17:80873220-80873242 CCCAGTGGCAGGGCTGGCAAAGG - Intronic
1152612338 17:81322042-81322064 GCCACAGGGAGTGCTGGGAAAGG - Intronic
1157824415 18:50799981-50800003 ACCACCAGGAGGGCAGGGACCGG + Intronic
1158950135 18:62486746-62486768 CCTACTAGGAAGGCTGAGATGGG + Intergenic
1160083481 18:75753196-75753218 TCCACTCTGAGGACTGGGAACGG + Intergenic
1160275001 18:77423678-77423700 ATCACTGGGAGGGCTGTGAAAGG - Intergenic
1160731305 19:642812-642834 ACCACGAGGAAGGTTGGGAAAGG - Intronic
1160897602 19:1409946-1409968 CCCGCTTGGAGGGCTGGGCCTGG + Intronic
1160946663 19:1646974-1646996 CCCCCTACCAGGGCTGGGTATGG + Intronic
1161167324 19:2795280-2795302 CACACTAGGATGGCCAGGAAAGG - Intronic
1161510019 19:4665068-4665090 GCCACCAGGAGGGCGGGGCAGGG - Intronic
1161684549 19:5696410-5696432 CCCACTGGGCGGGCTGGCCAGGG - Intronic
1161733828 19:5978327-5978349 CCGACTGAGAGGGCGGGGAAAGG + Intergenic
1161950457 19:7464897-7464919 CCCAAGAGGAAGGCTGGGGAGGG + Intronic
1162467210 19:10849398-10849420 CCCATTTGGAGAGCTGGGGAAGG - Intronic
1162978322 19:14221772-14221794 CCCTCCAGGAGGGATGGGTAGGG - Intergenic
1163578561 19:18124537-18124559 CCCAGTGGGTGAGCTGGGAAGGG + Intronic
1163800026 19:19359029-19359051 GCCCCTGAGAGGGCTGGGAAGGG - Intergenic
1164615690 19:29665660-29665682 CCCAAGAAGAGGCCTGGGAAGGG + Intronic
1165252249 19:34549045-34549067 CCCTCTGGGTGGCCTGGGAAAGG + Intergenic
1166291247 19:41864964-41864986 CCCACTAGAAGGGAGAGGAAGGG - Intronic
1166324115 19:42038618-42038640 CCCAGCTGGAGGGCTGGAAAGGG + Intronic
1166881118 19:45930703-45930725 CCTAGAAAGAGGGCTGGGAAGGG - Intergenic
925531963 2:4873887-4873909 CCCACAAGTGGGGCTGGCAATGG - Intergenic
925730774 2:6918084-6918106 CCCAAGAGGAGGTCTGGGAAAGG + Intronic
926117779 2:10224281-10224303 CCCACCAGGAGGGGAGAGAACGG + Intergenic
926193027 2:10742514-10742536 CCCAGCAGGAGGGCTGGAATTGG - Intronic
928489731 2:31769252-31769274 CCCAATGTGAGGGCTGGGCATGG + Intergenic
929038668 2:37722101-37722123 CCCACTATGAGGCCATGGAAAGG - Intronic
929648831 2:43657262-43657284 ACTACTAGGAGGGCTGAGATGGG - Intronic
932023005 2:68106976-68106998 CCAACTAGGAAGGCTAGGATGGG + Intronic
932282686 2:70508152-70508174 AAGACTAGGAGGGCTGGGCATGG + Intronic
932449700 2:71801777-71801799 CCCAGTGAGGGGGCTGGGAAGGG - Intergenic
933988998 2:87620032-87620054 CCCACCAGGAGAGGTGGGAGGGG + Intergenic
934067106 2:88350574-88350596 CCCACTTGGAGGTCTGGGTGGGG + Intergenic
934219806 2:90072410-90072432 ACCATTAGGAGGGCAGGGACCGG + Intergenic
936304845 2:111330794-111330816 CCCACCAGGAGAGGTGGGAGGGG - Intergenic
937223993 2:120357751-120357773 CCTATTAGAATGGCTGGGAATGG + Intergenic
937255513 2:120552675-120552697 GGCATTTGGAGGGCTGGGAAGGG - Intergenic
938041914 2:128083089-128083111 TCCCCCAAGAGGGCTGGGAAAGG + Intergenic
938380589 2:130834329-130834351 CCCACTAGGGAGGCTGGGGCTGG - Intergenic
940187409 2:151002514-151002536 GCCACTTGGAGGGCTGGGGCGGG + Intronic
941857806 2:170248244-170248266 CCCACTTGAAGGGCTGAGGAGGG + Intronic
943249540 2:185500010-185500032 CCCACTGGGAAGGTTGGGAAGGG + Intergenic
946403526 2:219481117-219481139 CCCATCAGGGGGGCTGGGGAGGG + Intronic
947291876 2:228584766-228584788 ACCATTAGAAGAGCTGGGAATGG - Intergenic
947976795 2:234373613-234373635 CCCACTGGGTGAGCTGGGGAAGG + Intergenic
948346239 2:237301084-237301106 CCCACTGGGAGTGCTGGGTCTGG - Intergenic
948826596 2:240576061-240576083 GCCACTGGGAGGGCTGTGCATGG + Intronic
1170597579 20:17817318-17817340 CCCACCAGGAGGTTGGGGAAAGG - Intergenic
1170687543 20:18583108-18583130 TGCACAAGGAGGGCTGGGCATGG + Intronic
1172675816 20:36671028-36671050 GCCATTAGGAGGTCTGGGAAAGG - Intronic
1174064011 20:47851835-47851857 CCCAAGAGGACTGCTGGGAAAGG + Intergenic
1175739364 20:61409921-61409943 CTGACTAGGAGGCCTGGGCAAGG - Intronic
1175741045 20:61420012-61420034 CCCACTAAGAGGGCTGTGGCTGG - Intronic
1178875993 21:36414247-36414269 GTCACGAGGAGAGCTGGGAAGGG + Intronic
1180033216 21:45226613-45226635 TCCACTAGCAGGCCTGGGTATGG + Intergenic
1180842770 22:18966973-18966995 CCCACTCAGAGTGCAGGGAAGGG + Intergenic
1180979380 22:19871606-19871628 TCCGCTGGGAGGGCTGGGGAGGG + Intergenic
1182662998 22:31938239-31938261 CCCACTGGGTGGGCTGGGTTGGG - Intronic
1183108414 22:35630635-35630657 CCAGCAAGGAGGACTGGGAAGGG + Intronic
1183520179 22:38292400-38292422 CTCACCAGGAGGGCAGAGAAGGG - Intronic
1184822784 22:46923283-46923305 CACACTGGGAGGGCTGGAGAAGG + Intronic
1185220500 22:49627120-49627142 CCCACCAGGAGGGCAGGGGTGGG + Intronic
950531268 3:13553537-13553559 CCCACGAGGGGCCCTGGGAAAGG - Intronic
950612745 3:14136740-14136762 AACATTAGGAGGGCGGGGAAGGG + Intronic
950967543 3:17156462-17156484 CAAACTAGGAGGGATGGGGAGGG - Intergenic
952285521 3:31964454-31964476 CCCATTAAGAGTGCTGGGTAGGG - Intronic
952872357 3:37912173-37912195 CCCACTTGCGGGGCTGTGAAAGG - Intronic
953337813 3:42108659-42108681 TCCACAAGCAGTGCTGGGAATGG - Intronic
954404992 3:50340741-50340763 CCCGCTGGGCGCGCTGGGAAGGG - Exonic
955627584 3:60935014-60935036 CTCACTAGGAGGTTTGGGGAAGG - Intronic
956435527 3:69231397-69231419 CCTACTGGGAGGGCTGAGGAAGG - Intronic
958601226 3:96299105-96299127 ACCACAAGGAGGACTGAGAAAGG - Intergenic
959248802 3:103912354-103912376 CTGAACAGGAGGGCTGGGAAGGG - Intergenic
961852449 3:129834690-129834712 CCCATTAGTATGGCTGGGAATGG + Intronic
961866079 3:129954468-129954490 CCCACCTGCAGGGCTGGGAAAGG - Intergenic
961950713 3:130746675-130746697 CCCTCGAGGAGGGCTCGGACGGG - Exonic
962381134 3:134898948-134898970 TCCACTTGGAGGGCAGGGAGTGG + Intronic
962899513 3:139746793-139746815 CCCACTAAAAGGGGTGGGAGTGG + Intergenic
963067362 3:141274284-141274306 TCCAGGAGGAAGGCTGGGAAGGG - Intronic
963539785 3:146570939-146570961 CCCACTAGTAGGACTAGGACTGG + Intergenic
964052058 3:152406511-152406533 GCCACTGAGAGGGCTGAGAAAGG - Intronic
964065422 3:152572195-152572217 ACCACAAGGAGGGCAGGTAAGGG + Intergenic
965422330 3:168476826-168476848 TCCACTTTGAGGACTGGGAAGGG + Intergenic
967114800 3:186327509-186327531 TCTACTGGGAGGGCTGGGAGGGG - Intronic
968953985 4:3708916-3708938 CCCAGCAGGAGGGTTGGGCATGG - Intergenic
969675678 4:8613097-8613119 CCCACGAGCAGAGCTGGGAGAGG + Intronic
970474747 4:16410870-16410892 CCCACCAAGAGGCCAGGGAATGG + Intergenic
980219857 4:129901021-129901043 CCCAGGAGAAGGGATGGGAATGG - Intergenic
981986288 4:150861414-150861436 CACAATATAAGGGCTGGGAATGG - Intronic
985318909 4:188687318-188687340 TCCCCTAAGAGGGCAGGGAAGGG - Intergenic
986177844 5:5366953-5366975 CACACTGGGAGGGCTGCGCACGG - Intergenic
986828248 5:11545208-11545230 GCTACTAGGAGGGCTGTGGAAGG + Intronic
988632604 5:32946922-32946944 GCCTCTAGGAAGGCTGGGAAAGG + Intergenic
991054986 5:62310398-62310420 CCCAGTAGTGGGGGTGGGAATGG - Intronic
992913737 5:81425917-81425939 CACAGAAGGAGGCCTGGGAAGGG - Intronic
995120566 5:108531812-108531834 CGCACTAGGAGGGCAGGGTGGGG + Intergenic
995835907 5:116399354-116399376 CCTACTAGAAAGGCTTGGAAGGG - Intronic
997205549 5:132047060-132047082 AGCACTAGGAGGCCTGGGCAGGG - Intergenic
997299006 5:132788737-132788759 CCCACTTGGAGGGGAGGGGAAGG + Intronic
998352102 5:141508533-141508555 CCCACGAGGTGGGCGGGGGATGG + Intronic
999238490 5:150114114-150114136 CGCACGGGGAGGGTTGGGAAGGG - Exonic
1002044353 5:176533603-176533625 CCCACTTTGAGGGCTGGGTTGGG - Intronic
1002075962 5:176708693-176708715 CACATTTGGAGGGCTGGGAGGGG - Intergenic
1002192962 5:177488327-177488349 CCCACCAGGAGGCCTTGGGAGGG + Intronic
1002346900 5:178554467-178554489 CACACCAGGAGGGCTGGGCGTGG - Intronic
1002534616 5:179869469-179869491 CCCACTAGGAGGGCCATGAGTGG - Intronic
1006518003 6:34555394-34555416 CCCAGTAGCTGGGCTGGGCAGGG - Intronic
1009836287 6:69005598-69005620 CTCACTAGGTCGGCCGGGAATGG - Intronic
1010074783 6:71787049-71787071 ACCACAAGGAGGACTGGGGAAGG - Intergenic
1010768524 6:79803059-79803081 ACCATTAGAAGGGCTGGGTAAGG - Intergenic
1013846623 6:114460276-114460298 CCCACGAGGTGGGCCGGGAGCGG - Intergenic
1016841982 6:148533903-148533925 CCCACCAGGAGGCGTCGGAAAGG + Exonic
1017040883 6:150307818-150307840 CCCACCTGCATGGCTGGGAATGG + Intergenic
1018629464 6:165809746-165809768 CCCACTAGGAGGGCTGGGAAGGG - Intronic
1019178781 6:170174851-170174873 CCCAGGAGGAGGCCTGGGACAGG - Intergenic
1019621472 7:1994502-1994524 CCCAGTAGGAGGACTGGGCAGGG + Intronic
1021579803 7:22140785-22140807 CCAGCTAAGAGGGCTTGGAATGG + Intronic
1021996504 7:26183107-26183129 CCAACTGGGAGGGCTGGCTATGG + Intronic
1022175351 7:27867179-27867201 CTCAAAAGGAGGGCTGGGAAAGG + Intronic
1023798336 7:43811940-43811962 CCCACAAGGAGGGGTGGGGGAGG + Intergenic
1026875432 7:73876688-73876710 CCCATTAGAGGGGATGGGAAGGG + Intergenic
1028871239 7:95773044-95773066 CCCACCTTGTGGGCTGGGAAGGG + Intronic
1029277524 7:99416015-99416037 CCCACTAGGATGGCTGTGGGTGG - Intronic
1031923211 7:127615963-127615985 CCAGCTGGGAAGGCTGGGAAGGG + Intergenic
1032094204 7:128929530-128929552 GCCCCTGGCAGGGCTGGGAAGGG - Intergenic
1035947242 8:3978843-3978865 CCTAATGGGAGCGCTGGGAAGGG - Intronic
1036548913 8:9799729-9799751 CCCACAAGGAGGCCAGGGCAGGG + Intergenic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1038662258 8:29507396-29507418 CCCACAAGTAGGACTGGGCATGG - Intergenic
1038828608 8:31033323-31033345 CCCGCCAGGAGGGGAGGGAAGGG + Exonic
1038853176 8:31300476-31300498 CCCACCAGGAAGGTTGGGGATGG - Intergenic
1041457509 8:58076447-58076469 CCGACCAGCAGGCCTGGGAATGG + Intronic
1043000941 8:74758959-74758981 CCCACTGGGATGGCTGAGATGGG + Intronic
1043931663 8:86098636-86098658 CCCAATAGTAAAGCTGGGAAGGG + Intronic
1045687145 8:104723908-104723930 GCCACTGGGAGGGCAGGGAGAGG + Intronic
1047564701 8:126031238-126031260 GCCCCTAGGAGAGCTGGGATGGG - Intergenic
1047615610 8:126559990-126560012 GCTACTGGGATGGCTGGGAATGG + Intergenic
1048063219 8:130942077-130942099 GCTGCAAGGAGGGCTGGGAATGG - Intronic
1048675716 8:136777160-136777182 CCCACTATTGGGGCTTGGAAGGG - Intergenic
1049270875 8:141695581-141695603 ACCCCTAGGGAGGCTGGGAAAGG + Intergenic
1049742820 8:144249178-144249200 CACCCGAGGAGGGCTGGGCAGGG - Intronic
1052712360 9:32072029-32072051 TCCATTAGGATGGATGGGAAAGG - Intergenic
1055357890 9:75456248-75456270 CCCAATAGAAAGGCTGGAAATGG + Intergenic
1057003023 9:91530397-91530419 CCCCTTTGGAGGGCTGGGGAGGG + Intergenic
1057338869 9:94181245-94181267 CCTATGGGGAGGGCTGGGAAAGG + Intergenic
1057695073 9:97317260-97317282 CCCACCAGGGGGGCTGGCAAAGG + Intronic
1057845175 9:98517312-98517334 CCCACAGGAAGGGGTGGGAAAGG - Intronic
1059717892 9:116930672-116930694 CTCAGTAGAAGGGCAGGGAAGGG + Intronic
1061035008 9:128108634-128108656 CCCACTGGGCGGGCTTGGGAAGG - Exonic
1061429282 9:130520990-130521012 CCCCATGGGAGGGCTGGGAGCGG + Intergenic
1061817079 9:133203921-133203943 CCCACTTGGAGGGCCTGGCATGG - Intergenic
1185816656 X:3162755-3162777 TCCACTTGGAGGCCTGGAAAGGG + Intergenic
1186979055 X:14939598-14939620 CCCCCAAGGTGGGCTGGGCATGG - Intergenic
1187188857 X:17013814-17013836 CCCTGTAGCAGGGCTGGGAGAGG - Intronic
1187238785 X:17493883-17493905 CCAACCAGGAGGGCAGGGCAGGG + Intronic
1189482168 X:41400409-41400431 CCCACTAAGATGGTTGGCAAAGG - Intergenic
1192152210 X:68719377-68719399 CCCACAAGCAGGGCTGGGTCTGG + Exonic
1196744912 X:119062963-119062985 CCCACTGAGAGGGCTGGGGGAGG - Intergenic
1196747917 X:119088049-119088071 GCCTCTCCGAGGGCTGGGAAAGG + Exonic
1196935367 X:120725197-120725219 GCCACTAGGGTGGCTGGGCATGG - Intergenic
1197958528 X:131978888-131978910 CCCACTAGCATGGGTGGGAGGGG + Intergenic
1198562198 X:137863025-137863047 CCCAGTAGGAGGGCTCCTAATGG + Intergenic
1199085759 X:143629270-143629292 CCCACCAGGAGGACTTCGAATGG + Exonic
1200048123 X:153413373-153413395 CACGCGGGGAGGGCTGGGAAGGG - Intergenic
1200053881 X:153448698-153448720 ACCACCAGGATGGCAGGGAAGGG + Intronic
1200092039 X:153640503-153640525 GACACCAGGAGGGCTGGGAGTGG + Intergenic
1200249142 X:154542907-154542929 CCCATGAGGAGGGCAGGGACTGG + Intronic
1200327813 X:155260881-155260903 CAATCCAGGAGGGCTGGGAAGGG - Exonic
1200686467 Y:6264038-6264060 CTCAGTGGGAGAGCTGGGAAGGG - Intergenic
1200688007 Y:6274208-6274230 CTCAGTGGGAGAGCTGGGAAGGG - Intergenic
1200954410 Y:8929858-8929880 CTCAGTGGGAGAGCTGGGAAGGG - Intergenic
1200958198 Y:8972185-8972207 CTCACTGGGAGAGCTGGGAAGGG - Intergenic
1200979527 Y:9248883-9248905 CTCAATGGGAGAGCTGGGAAGGG - Intergenic
1200992010 Y:9355285-9355307 CTCAGTGGGAGAGCTGGGAAGGG - Intergenic
1200994665 Y:9375565-9375587 CTCAGTGGGAGAGCTGGGAAGGG - Intronic
1200997328 Y:9395911-9395933 CTCAGTGGGAGAGCTGGGAAGGG - Intergenic
1200999842 Y:9464448-9464470 CTCAGTGGGAGAGCTGGGAAGGG - Intergenic
1201002501 Y:9484757-9484779 CTCAGTGGGAGAGCTGGGAAGGG - Intronic
1201005160 Y:9505044-9505066 CTCAGTGGGAGAGCTGGGAAGGG - Intergenic
1201007819 Y:9525371-9525393 CTCAGTGGGAGAGCTGGGAAGGG - Intergenic
1201010435 Y:9545561-9545583 CTCAGTGGGAGAGCTGGGAAGGG - Intergenic
1201047260 Y:9900494-9900516 CTCAGTGGGAGAGCTGGGAAGGG + Intergenic
1201305153 Y:12543340-12543362 GACACTAGGAGGTATGGGAAAGG - Intergenic
1202111486 Y:21426629-21426651 CTCAGTGGGAGAGCTGGGAAGGG + Intergenic
1202116958 Y:21477508-21477530 CTCAGTGGGAGAGCTGGGAAGGG - Intergenic
1202232536 Y:22671247-22671269 CTCAGTGGGAGAGCTGGGAAGGG - Intergenic
1202310620 Y:23524911-23524933 CTCAGTGGGAGAGCTGGGAAGGG + Intergenic
1202560182 Y:26145683-26145705 CTCAGTGGGAGAGCTGGGAAGGG - Intergenic