ID: 1018635925

View in Genome Browser
Species Human (GRCh38)
Location 6:165859439-165859461
Sequence AAGTGGCCCCCAAGGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018635925_1018635931 17 Left 1018635925 6:165859439-165859461 CCTCCTTCCCTTGGGGGCCACTT 0: 1
1: 0
2: 2
3: 13
4: 199
Right 1018635931 6:165859479-165859501 CATTTACTGATTTATTATAAGGG No data
1018635925_1018635932 29 Left 1018635925 6:165859439-165859461 CCTCCTTCCCTTGGGGGCCACTT 0: 1
1: 0
2: 2
3: 13
4: 199
Right 1018635932 6:165859491-165859513 TATTATAAGGGATATTACAAAGG 0: 7
1: 118
2: 318
3: 406
4: 759
1018635925_1018635930 16 Left 1018635925 6:165859439-165859461 CCTCCTTCCCTTGGGGGCCACTT 0: 1
1: 0
2: 2
3: 13
4: 199
Right 1018635930 6:165859478-165859500 ACATTTACTGATTTATTATAAGG 0: 1
1: 4
2: 17
3: 81
4: 691

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018635925 Original CRISPR AAGTGGCCCCCAAGGGAAGG AGG (reversed) Intronic
900010738 1:104990-105012 CAGTGGCCCCCAACAGCAGGTGG - Intergenic
900026841 1:281554-281576 CAGTGGCCCCCAACAGCAGGTGG - Intergenic
900338174 1:2175146-2175168 GAGTGGCCACCAAGGAGAGGGGG + Intronic
902684688 1:18068309-18068331 AAGTGGCCCATAAGGGGTGGAGG - Intergenic
902882506 1:19381988-19382010 AAGGGCCACCCAGGGGAAGGAGG - Intronic
905372377 1:37490180-37490202 CAGTGGCCTCCAAGGGGAAGAGG - Intergenic
905503685 1:38459520-38459542 CAGTGGCCACCAAAGGAAGTTGG - Intergenic
907335601 1:53697460-53697482 CAGTGGCCCCCAGAGGAGGGTGG - Intronic
910901839 1:92129672-92129694 AAATGGCCCTAAAGGGAAGAGGG - Exonic
911321737 1:96421803-96421825 CAGTGCCCCACGAGGGAAGGAGG - Intergenic
912821819 1:112874054-112874076 AAGTAGGCCCCAAGAGGAGGTGG + Intergenic
912957485 1:114165683-114165705 AAGAGGCCCATGAGGGAAGGAGG + Intergenic
915079861 1:153344792-153344814 AAGAGGGGCCCAAGGGAGGGAGG - Intronic
915780712 1:158547142-158547164 AAGTGGGCCCCAGGGAAATGGGG - Exonic
916353503 1:163878613-163878635 GAGGGCCCACCAAGGGAAGGAGG - Intergenic
916812689 1:168319322-168319344 AAGTGGCTGCCTAGGGGAGGGGG - Intergenic
917032932 1:170714764-170714786 AAGTTGCCCTAGAGGGAAGGTGG - Intronic
919117731 1:193301686-193301708 AAATGGACCCCAAAGGATGGTGG + Intergenic
920387650 1:205580028-205580050 AAGTGGGCCCCTGGGGGAGGAGG - Intronic
920619653 1:207532340-207532362 AAGTGACCCTCAAGGGAATGGGG + Exonic
920621435 1:207550895-207550917 AAGTGACCCTCAAGGGAATGGGG + Exonic
920623062 1:207567984-207568006 AAGTGACCCTCAAGGGAATGGGG + Exonic
920624599 1:207584809-207584831 AAGTGACCCTCATGGGAATGGGG + Exonic
920627471 1:207616735-207616757 AAGTGACCCTCAAGGGAATGGGG + Exonic
922259179 1:223920999-223921021 CAGTGGCCCCCAACAGCAGGTGG - Intergenic
922745413 1:228040262-228040284 AAGTGGCCCCAACAGGAAGATGG - Intronic
924048460 1:240056119-240056141 AAGAGGCCCCCAAGTGGAGATGG + Intronic
924340366 1:243023747-243023769 CAGTGGCCCCCAACAGCAGGTGG - Intergenic
924382268 1:243475445-243475467 AAGAGGCGCCGGAGGGAAGGGGG - Intronic
1066323355 10:34327847-34327869 AAGTGGGCCTCAGGGGAAGTGGG - Intronic
1066736130 10:38481865-38481887 CAGTGGCCCCCAACAGCAGGTGG + Intergenic
1067571974 10:47378295-47378317 AGGTGGCACCCATGGGGAGGTGG + Intronic
1069606751 10:69743685-69743707 ATTTGGCCGCCAAGGGAGGGTGG + Intergenic
1069889482 10:71644181-71644203 AAGTGGCTCCCCAGGGGATGTGG - Intronic
1072031345 10:91525354-91525376 AAGTGGTCCCCAGAGGTAGGAGG + Intergenic
1073486781 10:103824172-103824194 AGGTGGCCCCAAGGGGAGGGTGG + Intronic
1075515233 10:123103128-123103150 AGATGGCCCCCAAGGGGTGGTGG - Intergenic
1078011480 11:7576174-7576196 AGGTGACCCCCAAGGGAACTGGG + Intronic
1079121052 11:17685299-17685321 AGGCTGCCCCTAAGGGAAGGTGG + Intergenic
1079253274 11:18803576-18803598 AAGTGGACTCCAAGGGAATCTGG + Intergenic
1083616740 11:64029950-64029972 AGGAAGCTCCCAAGGGAAGGAGG + Intronic
1083976626 11:66127213-66127235 ATGTCTCCCCGAAGGGAAGGAGG + Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1085921036 11:80957378-80957400 GAGTGGTGCCCAAGGCAAGGAGG + Intergenic
1088091161 11:106041567-106041589 AAGTGCACCCCAAAGGAAAGAGG + Intergenic
1088123380 11:106395363-106395385 ATGTGGCTGCCAAGGCAAGGGGG + Intergenic
1090978531 11:131696099-131696121 AGCCGGCCCCCAGGGGAAGGAGG + Intronic
1092164901 12:6336669-6336691 AAGTGGCCCTCAGGGAAGGGAGG - Intronic
1092919510 12:13218621-13218643 GTGTGGAGCCCAAGGGAAGGCGG + Exonic
1094794431 12:33954453-33954475 AAGTGGGGCCCAATGGAAAGTGG - Intergenic
1095987677 12:48010509-48010531 AAGGGGCCACCACGGGAAGGAGG - Intergenic
1101329600 12:103746792-103746814 AAGTGGCCCAGACAGGAAGGAGG - Intronic
1101603367 12:106229648-106229670 AAGTGGTCACCAAATGAAGGAGG + Intergenic
1101829968 12:108249371-108249393 AAAGGGCCCCCAAGGGAAGCTGG - Exonic
1101850335 12:108396877-108396899 AGGGGGCCCTGAAGGGAAGGAGG + Intergenic
1102313482 12:111866011-111866033 AACTTGCCCCCAAGGGTAGCAGG - Intronic
1103209600 12:119156810-119156832 AAGGGGCCCCCACGGGCAGCTGG - Exonic
1108046553 13:46388917-46388939 AGGCTGCCCCCAAGGGAAGCAGG - Intronic
1108451822 13:50574885-50574907 AGGTGGCCCCCTGGGGAAGAAGG + Intronic
1109797231 13:67331683-67331705 AAGTGGCTCCAAAGGGAAGGGGG - Intergenic
1110328895 13:74248881-74248903 AAGTGGGGAACAAGGGAAGGAGG + Intergenic
1112089707 13:96069818-96069840 AAGTGTCCCACTAGGGAATGGGG + Intergenic
1117275441 14:54188624-54188646 ACATGGCACACAAGGGAAGGAGG - Intergenic
1119061387 14:71478689-71478711 AAGGGGAACCCCAGGGAAGGAGG - Intronic
1123105438 14:105839200-105839222 ATGGGGCCCCGAAGGGGAGGGGG + Intergenic
1123787934 15:23690923-23690945 CAGTGGCCCCCTAGGGAGGCTGG - Intergenic
1124052213 15:26207961-26207983 AAGTGAGCCCATAGGGAAGGAGG + Intergenic
1124218016 15:27825530-27825552 AAGCTGCCCCCTAGGAAAGGAGG + Intronic
1124398078 15:29322771-29322793 AAGTGGGCAGGAAGGGAAGGAGG - Intronic
1125475873 15:40047732-40047754 AGGTGGACGGCAAGGGAAGGGGG - Intergenic
1125530589 15:40410858-40410880 GACTGGCCCCCAAGGGGAGAGGG - Intronic
1127638520 15:60893641-60893663 AAGAGGCTCCTAAGGGAAGCGGG + Intronic
1131176330 15:90211797-90211819 AAGGGGCCTCCAATGCAAGGAGG - Intronic
1132346356 15:101111409-101111431 AGCAGGTCCCCAAGGGAAGGAGG - Intergenic
1134822391 16:17257218-17257240 AAGTAGGCTCCCAGGGAAGGTGG + Intronic
1134904582 16:17969432-17969454 GAGTGGTCCCCAAAGCAAGGAGG - Intergenic
1134915759 16:18069594-18069616 AAGTGTCCCCCTAAGGAGGGGGG + Intergenic
1135609453 16:23853467-23853489 AAGAGGCAACCAACGGAAGGGGG + Intronic
1141382906 16:83591746-83591768 AAGTGGCTCCCCAGGGCAGCAGG - Intronic
1142387341 16:89774305-89774327 AAGTGGACCCCAGGGGAAGGAGG + Intronic
1142453609 16:90201926-90201948 CAGTGGCCCCCAACAGCAGGTGG + Intergenic
1143099309 17:4496761-4496783 AAGGGGCCACCAAGGGCAGAGGG - Intergenic
1143416747 17:6756242-6756264 CCGTGGGCCCCAAGGGTAGGAGG + Intronic
1143503742 17:7352853-7352875 ACGGGGCCCCCAAAGGAGGGGGG - Exonic
1144360934 17:14491626-14491648 AAGTGGTTGCCTAGGGAAGGGGG - Intergenic
1145848708 17:28069082-28069104 AAGTGGCTGCCTAGGGCAGGGGG - Intronic
1146268080 17:31466220-31466242 CAGTGGGTCCCAGGGGAAGGAGG + Intronic
1146566243 17:33915454-33915476 AAGAGGACCCCAAGGCAAGTAGG - Intronic
1147944937 17:44075596-44075618 GAGTGGGCCCCAAGGGCAGATGG + Intronic
1148550671 17:48548797-48548819 AAATTTCCCCCAAGGGAAGAAGG - Intergenic
1151778440 17:76225769-76225791 AAGAGGTCCGCAAGGCAAGGGGG - Intronic
1152488762 17:80614247-80614269 AAGTGGCCTCCCCGAGAAGGGGG + Intronic
1152587989 17:81197592-81197614 ACCTGGCCCCCAGGGGGAGGAGG - Intronic
1153851120 18:9095487-9095509 AAGTGGGCCCCAGAGGAAGAAGG + Intergenic
1154065665 18:11104791-11104813 GAGTGGTCCCCAAGAGAAGCAGG - Intronic
1155620429 18:27772094-27772116 CTGTGGCCCCAAAGGGATGGTGG + Intergenic
1155630380 18:27886310-27886332 CAGTGGTCCCCAAGGGAATGAGG - Intergenic
1156373073 18:36488908-36488930 AAATGGCCCCCAAGAGCAGGTGG + Intronic
1156462851 18:37331418-37331440 AAGTAGCCCTCAAGGGGATGAGG + Intronic
1157675494 18:49565602-49565624 AAGCAGCCCACAAGGAAAGGGGG - Intronic
1160247098 18:77167713-77167735 AAGTGTTCCCCAAAGGAAAGGGG - Intergenic
1160941837 19:1623776-1623798 AGGCCGCCTCCAAGGGAAGGCGG - Intronic
1160944097 19:1633192-1633214 CTGTGGCCCCCGATGGAAGGGGG - Intronic
1161972470 19:7590403-7590425 AACAGGCCCCCAGGGGCAGGTGG + Intergenic
1163440964 19:17322389-17322411 AAGGGGACCCCAAAGGCAGGAGG - Exonic
1163721730 19:18901096-18901118 AGGTGGCTCCAAAGGGAAGTGGG + Intronic
1163944619 19:20523667-20523689 AACTTGCCACCAAGGGAATGTGG + Intergenic
1165121912 19:33565352-33565374 AAGGGGGCCCCAAGGGCAGATGG - Intergenic
1165855753 19:38878625-38878647 AAGTGGGTCCCACGTGAAGGGGG + Exonic
1167762915 19:51460648-51460670 AAGTTCACCACAAGGGAAGGGGG + Intergenic
1168504208 19:56919608-56919630 AAGTGGCACCCCTGGGGAGGCGG + Intergenic
925006231 2:445001-445023 AAGTCGCGCCCCTGGGAAGGTGG + Intergenic
925838263 2:7966411-7966433 AATTGTCCCAAAAGGGAAGGAGG + Intergenic
925988977 2:9238482-9238504 GAGCAGCCCCCATGGGAAGGTGG - Intronic
926112911 2:10194273-10194295 AAGTGGCCTCTAAGCAAAGGCGG + Intronic
926953075 2:18265168-18265190 AAGTGGGCACCAAAGGAAGCAGG - Intronic
927096544 2:19751537-19751559 CACCGGCGCCCAAGGGAAGGTGG + Intergenic
927285863 2:21356214-21356236 CAGTTGCCCCCAGGGTAAGGAGG - Intergenic
928994705 2:37275388-37275410 AATTGGCACCCAAGGTAAGGTGG + Intronic
929917737 2:46150345-46150367 AAGGTGGCCCCAAAGGAAGGGGG + Intronic
935103648 2:100019894-100019916 AAGTGGCATCTATGGGAAGGTGG - Intronic
937089878 2:119199063-119199085 GAGTGGCTTCCAGGGGAAGGTGG - Intergenic
937305359 2:120867445-120867467 AAGTGGCCGCCGAGGGAGGCGGG - Intronic
938097775 2:128474702-128474724 AAGAGACCCCCAAAGGCAGGAGG + Intergenic
939413804 2:141866084-141866106 TAGTGACCCCCCAGGGAAGAGGG + Intronic
943043581 2:182831895-182831917 AAATGGCACCGAATGGAAGGTGG + Intergenic
945047974 2:205798675-205798697 AAGTGGCTCTCAATGGAATGGGG + Intergenic
946366826 2:219253792-219253814 AAGTGTCCCCCAAAGGAGAGGGG + Intronic
948561538 2:238857035-238857057 CAGAGGCCCCCAGAGGAAGGTGG + Intronic
949085053 2:242146584-242146606 CAGTGGCCCCCAACAGCAGGTGG + Intergenic
1168889703 20:1286993-1287015 AAGTGGGTCCCAAGGAAAGATGG - Intronic
1173564821 20:44031149-44031171 AAGTGGTACACAAGGGCAGGTGG + Intronic
1173828522 20:46062922-46062944 AAGTACCCCCCAAGGGCAGGAGG + Intronic
1174609087 20:51784411-51784433 AGGTGGCCCCCAAGGAAACCGGG + Exonic
1175010999 20:55735840-55735862 TAGTGGCCCCCAAAGATAGGAGG - Intergenic
1178108586 21:29348767-29348789 AAGTTGCCTCCTAGGGATGGAGG + Intronic
1178517804 21:33263587-33263609 AAGTGTTCTCCAAGGGAAGGAGG + Exonic
1180998997 22:19979258-19979280 AAGGAGCCCCAAAGGGGAGGAGG + Intronic
1181884224 22:26006976-26006998 CAGTGGCCCCTCAGGCAAGGTGG + Intronic
1183713926 22:39522562-39522584 AAGAGGTCCGCAAGGCAAGGGGG + Exonic
1184501679 22:44878545-44878567 CAATGGCCCCCAAGGGATGCTGG + Intergenic
1185062177 22:48612752-48612774 GAGAGACCCCCATGGGAAGGTGG - Intronic
952509712 3:34040794-34040816 AATCAACCCCCAAGGGAAGGAGG + Intergenic
952791802 3:37206284-37206306 AACTTGCCACCAAGGGAATGTGG - Intergenic
953363586 3:42322541-42322563 AGCTGGCCCCCAAGGAAAGCAGG - Intergenic
954910019 3:54096720-54096742 GAGAGGCTCCAAAGGGAAGGCGG + Intergenic
962199726 3:133391395-133391417 AAGGGACCCACACGGGAAGGAGG - Intronic
966597539 3:181738020-181738042 CAGTGGCTCTCTAGGGAAGGAGG - Intergenic
968168958 3:196492906-196492928 AAGTGGCAATCAAGGGCAGGGGG + Intronic
968502881 4:959339-959361 CTGTGCCCCACAAGGGAAGGGGG + Exonic
968618769 4:1594167-1594189 TGCTGGCTCCCAAGGGAAGGAGG - Intergenic
968931653 4:3582553-3582575 GAGTGGTCCCCAAGGGGAGAGGG - Intronic
974025269 4:56728180-56728202 AAATGGCACCCCAGTGAAGGAGG + Intergenic
979262485 4:118664823-118664845 CAGTGGCCCCCAACAGCAGGTGG + Intergenic
983286416 4:165745218-165745240 AAGTAGCCTTCCAGGGAAGGGGG - Intergenic
985112253 4:186557628-186557650 ATTTGGTCCCCAGGGGAAGGCGG + Intergenic
987245359 5:16042859-16042881 AAGAGCTCCCCAAGGGAAGCAGG + Intergenic
989659765 5:43787284-43787306 TACTTGCCCCCCAGGGAAGGTGG - Intergenic
995284260 5:110368765-110368787 AAGTGGCTCTCAGTGGAAGGGGG + Intronic
995555958 5:113328953-113328975 TATGTGCCCCCAAGGGAAGGAGG - Intronic
997699746 5:135888747-135888769 AAGTCAACCCCAGGGGAAGGTGG - Intergenic
998052403 5:139046824-139046846 AACTGGCCCCAAAGGGAGGAAGG - Intronic
998962616 5:147504764-147504786 AAGAGGCCCACATGGGAAGAAGG + Intronic
999310782 5:150550595-150550617 GAGGGGACCCCAAGAGAAGGAGG + Intronic
999424291 5:151473690-151473712 AAGGGGCCACCAAGGGGAGGTGG - Exonic
1001083262 5:168682200-168682222 AAGAGGCTCCCAGTGGAAGGTGG - Intronic
1003235831 6:4294674-4294696 AAGTGGCCCCCAGAAGGAGGGGG - Intergenic
1003644696 6:7905027-7905049 GAGTAGGCCACAAGGGAAGGAGG - Intronic
1004876952 6:19965568-19965590 AAAAGGCCCCAATGGGAAGGTGG + Intergenic
1006364479 6:33607359-33607381 CAGGGGCCCCCACTGGAAGGTGG + Intergenic
1006419398 6:33923956-33923978 AAGTCCCCCCCATGGAAAGGTGG + Intergenic
1010011999 6:71058688-71058710 GAGTGGCTCCCAGGGAAAGGGGG - Intergenic
1014766075 6:125408212-125408234 AAGTGGCCCCCAAGGGCCAAAGG + Intergenic
1015403809 6:132815135-132815157 AACTGCCACCCAAGGGAAGAAGG + Intronic
1017580083 6:155854989-155855011 ATGCAGCCCCCAAGGGAATGCGG + Intergenic
1018635925 6:165859439-165859461 AAGTGGCCCCCAAGGGAAGGAGG - Intronic
1019361112 7:604570-604592 ACGTGCCCCCCACGGGGAGGCGG + Intronic
1021215003 7:17905012-17905034 AAGGGGAGACCAAGGGAAGGAGG + Intronic
1022837293 7:34130460-34130482 AAATGGCCTCAAAGTGAAGGAGG - Intronic
1025959174 7:66205437-66205459 GAGTGGCCCCCCACCGAAGGCGG + Exonic
1027139399 7:75646645-75646667 AAGTGGACCCCTGGGGAAAGGGG - Intronic
1027336618 7:77157694-77157716 AAGCAGCCCCCACTGGAAGGAGG - Intronic
1029779173 7:102713415-102713437 AAGCAGCCCCCACTGGAAGGAGG + Intergenic
1033084538 7:138330116-138330138 GAGTTGCCACCAAGGGAATGTGG - Intergenic
1033857173 7:145577859-145577881 AAGTGGCTCTCAAGGGGATGGGG + Intergenic
1035453580 7:158995414-158995436 CACTGGCCCCCGAGGGCAGGAGG - Intergenic
1036549488 8:9804048-9804070 GAGTTGCCACCAAGGGAATGTGG - Intergenic
1036751693 8:11447568-11447590 AAGTAGCCCCCAGAGGCAGGCGG + Intronic
1045063929 8:98428921-98428943 AAGTGGCCCCCAGGGAGCGGAGG - Exonic
1046876519 8:119260597-119260619 AAGTGACCCCCAAGTGCAGAAGG - Intergenic
1048051518 8:130821592-130821614 AATTGACCCCCAAGGGTATGAGG + Intronic
1048906865 8:139096936-139096958 AAGGGGCTTCCAAGGAAAGGAGG - Intergenic
1048923976 8:139254291-139254313 AAGCTGCCTCCCAGGGAAGGTGG + Intergenic
1052341533 9:27368862-27368884 AAGTGGCGCTCAGGGGTAGGAGG - Intronic
1054458472 9:65449374-65449396 GAGTGGTCCCCAAGGGGAGAAGG + Intergenic
1055003256 9:71477883-71477905 AAGTGGCCCTCAGGAGAAGTAGG + Intergenic
1056657586 9:88522076-88522098 AAGTCACCCCCAAAGGAAGAAGG + Intergenic
1056713991 9:89013663-89013685 AACTGGCCCAGAAGGAAAGGAGG + Intronic
1057165748 9:92924000-92924022 TTGTGGCCCCCAAGGAAAAGAGG - Intergenic
1059062953 9:111052754-111052776 AAGTGGCCACCATGGCAAAGAGG + Intergenic
1059235464 9:112757155-112757177 TAGTGGCTACCAAGGGCAGGTGG - Intronic
1061484062 9:130911529-130911551 AAGTGGCCTCCAAGGGCATGTGG + Intronic
1061521167 9:131118912-131118934 AATTGGCCCCAAAGGGAGGCAGG + Intronic
1061875535 9:133541731-133541753 AGGTGCTGCCCAAGGGAAGGAGG - Intronic
1062146898 9:134994539-134994561 AAGTGGCTCCCAGGGGCACGGGG + Intergenic
1062628482 9:137453473-137453495 AAGAGGCCCTCAGGGGCAGGGGG - Intronic
1188707311 X:33351296-33351318 CAGTGGCTGCCTAGGGAAGGTGG + Intergenic
1192321722 X:70095346-70095368 AAATGGCCCCCAAGGGCTGAGGG - Intergenic
1192368921 X:70497618-70497640 AACTGGCCCCAAAGGCAAAGAGG - Intronic
1193085483 X:77445295-77445317 AATGGGCCCCAAAGGGAAGATGG - Intergenic
1196898134 X:120358353-120358375 AAGTAGCCCCCAAGGTTAGAAGG - Intergenic
1198499235 X:137226205-137226227 AAGTGGCCAGGAAGGGAAGAAGG - Intergenic
1200841452 Y:7785642-7785664 AAGTGTTCCCCAAGGGAGTGTGG + Intergenic
1202384556 Y:24313285-24313307 CAGTGGCCCCCAACAGCAGGTGG + Intergenic
1202486228 Y:25356837-25356859 CAGTGGCCCCCAACAGCAGGTGG - Intergenic