ID: 1018637729

View in Genome Browser
Species Human (GRCh38)
Location 6:165879079-165879101
Sequence ATTTGGGGGTGCAACTGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018637729 Original CRISPR ATTTGGGGGTGCAACTGACC TGG Intronic
900711821 1:4119302-4119324 CTTTGGAGTTGCAGCTGACCAGG + Intergenic
904906637 1:33902224-33902246 AGTTGGGGGTGTAACTGAGATGG + Intronic
905061477 1:35143326-35143348 GTTTGGGGGTGCACCTGACTCGG + Intergenic
908006383 1:59733153-59733175 ATTTGGGGGTGCACAGGCCCGGG - Intronic
912003207 1:104860138-104860160 ATTCGGGTGTGGAACTGACCTGG + Intergenic
916102821 1:161407231-161407253 TGTTGGGGGTGCACCTGACTCGG + Intergenic
923049808 1:230382967-230382989 ATTTGGTGGGGCAGCTGTCCGGG + Intronic
1063950004 10:11213324-11213346 ATCTGGTGCTGCAGCTGACCTGG + Intronic
1065829382 10:29600488-29600510 ATGTGGAGGTGCAACAGGCCTGG - Intronic
1066050039 10:31625519-31625541 ATTTGTGGGTGCCACAGGCCTGG - Intergenic
1067227084 10:44383394-44383416 AGTTATGGGTGCAACTGACCTGG - Intronic
1070393824 10:75994194-75994216 AATTTCAGGTGCAACTGACCAGG + Intronic
1070661426 10:78308965-78308987 ATTTGGGGGTACAACTCAATGGG + Intergenic
1072765286 10:98089957-98089979 GGTTGGGGGTGGTACTGACCAGG - Intergenic
1074782001 10:116808895-116808917 ACATGGCGGTGCCACTGACCAGG + Intergenic
1078058214 11:8024891-8024913 ATTTTGGGGTCAAAGTGACCTGG + Intronic
1079938538 11:26648820-26648842 CTTTGGGTGTGCAGCTGATCCGG + Intronic
1083340579 11:61956091-61956113 ATTTGGGGGTCCAATTGGGCGGG + Intronic
1083621727 11:64052638-64052660 ACCTGGGAGGGCAACTGACCTGG + Intronic
1083860757 11:65418732-65418754 TTATGGGGCTGCAGCTGACCTGG + Intergenic
1086001876 11:81993229-81993251 ACTTGGGGGTGTAATTGAGCTGG + Intergenic
1090432726 11:126660014-126660036 ATTTGGGGTTGCTACTAAGCAGG + Intronic
1091020737 11:132097280-132097302 ATTTGGGAGTGTGATTGACCTGG + Intronic
1092446418 12:8561727-8561749 ATTTTGGGGTCTTACTGACCGGG + Intergenic
1096796532 12:54081600-54081622 GTTTGGGGGAGCAACTTGCCTGG + Intergenic
1098460224 12:70724860-70724882 TTTTGGTGGTGCAACTGGCTAGG + Intronic
1099178380 12:79449853-79449875 ATTTGAGGAAGCAACTGAACAGG + Exonic
1105926607 13:25014474-25014496 GTTGGGTGGTGCTACTGACCTGG + Intergenic
1106038421 13:26066788-26066810 GTTGGGTGGTGCTACTGACCTGG - Intergenic
1107854706 13:44603368-44603390 ATTTGGTGTTGCAGCTGACATGG + Intergenic
1113054664 13:106255150-106255172 ATTTGGGAGTTCATCTGACTAGG - Intergenic
1113104750 13:106759953-106759975 ATCTTGGGGTCCATCTGACCTGG + Intergenic
1121493906 14:94378855-94378877 AGTTGTGGGTGCACCTGAGCAGG - Intronic
1132069502 15:98763362-98763384 ATTGAGGGTTGCAAATGACCTGG + Intronic
1135474629 16:22763295-22763317 TTTTGGGGCTGGAGCTGACCAGG + Intergenic
1136473789 16:30499256-30499278 ATTTGGGGCGGCAGCTGCCCTGG - Intronic
1136685784 16:31994213-31994235 ACTCGGGTGTGCACCTGACCTGG - Intergenic
1136786397 16:32937746-32937768 ACTCGGGTGTGCACCTGACCTGG - Intergenic
1136883375 16:33916049-33916071 ACTCGGGTGTGCACCTGACCTGG + Intergenic
1140045747 16:71439481-71439503 ATTTGGGGGTGGTTCTGAGCTGG + Intergenic
1203088631 16_KI270728v1_random:1199412-1199434 ACTCGGGTGTGCACCTGACCTGG - Intergenic
1143341932 17:6218393-6218415 TTTGGTAGGTGCAACTGACCAGG - Intergenic
1147146737 17:38489886-38489908 ACTCGGGTGTGCACCTGACCTGG - Intronic
1149084544 17:52699578-52699600 ATTTGGGGTTTTAACAGACCTGG + Intergenic
1151990742 17:77572454-77572476 TTTTGGGTGTGGAGCTGACCAGG - Intergenic
1152813761 17:82394878-82394900 ATTCGGGGGTGTCACTGACCAGG - Intronic
1152883428 17:82833631-82833653 ATTTGGTGGTGCATCTGGACGGG - Intronic
1153226683 18:2905846-2905868 ATTTGGGGGCTCAAGTGATCCGG + Intronic
1153763743 18:8355546-8355568 ATTTGGGTGTGGAAGTGACAAGG + Intronic
1156892982 18:42211055-42211077 GATTGGGGTTGCAACTGACCTGG + Intergenic
1159492780 18:69159912-69159934 ATTTAGGGGTGCAAATGATGAGG - Intergenic
1161143568 19:2663931-2663953 ACTTGGGGGTGCTCCTGGCCTGG - Intronic
1161461308 19:4399550-4399572 ACTTGGGGGTGCTCCTGGCCCGG + Intronic
1163570261 19:18077453-18077475 ATTTGGGGGTGAAGGTGCCCTGG + Intronic
1163697614 19:18771916-18771938 ACTTGGGGGTGCAGCTGAGGTGG + Intronic
1168153750 19:54462253-54462275 AGGTGGGGGTGCAGCTGCCCTGG + Exonic
929433283 2:41907082-41907104 ATCTGGGTGTGCAACTGGGCTGG - Intergenic
933025520 2:77252777-77252799 ATTTGGGGGAGGAAATGACATGG + Intronic
936706085 2:115075455-115075477 ATTTGGGTTTGAAACTGACATGG - Intronic
937250842 2:120522783-120522805 ATTTGGGGGTAGAAGTGCCCAGG - Intergenic
937851211 2:126638082-126638104 ATGTGGGGGTGCAAATGGTCAGG + Intergenic
939323027 2:140649004-140649026 TTTTGGGGGTAGAACTGATCAGG + Intronic
944620875 2:201514982-201515004 GTTTAGGGGTGCATCTGACCTGG - Intronic
946191101 2:218008417-218008439 AGTCTGGGGTCCAACTGACCTGG + Intergenic
1168841594 20:913432-913454 ATATGGGAGTTCAGCTGACCTGG - Intronic
1171847992 20:30289615-30289637 GTTTGGGGGAGCAACTTGCCTGG + Intergenic
1179792858 21:43765500-43765522 ATTTGGGGGGACACCTGTCCAGG - Intergenic
1180135678 21:45860460-45860482 AGTTGGGGCTGCAACTTACATGG + Intronic
1183776069 22:39966568-39966590 AGTTGGGGGTGCTACAGACAGGG + Intronic
1185352531 22:50345758-50345780 ACTGGGGGGGGGAACTGACCGGG - Intronic
950107391 3:10396905-10396927 ACTTGGGGGTGAAACAGACTGGG - Intronic
951129528 3:19025270-19025292 ATTTGGGGTTTCAACTGATTGGG - Intergenic
952401820 3:32970314-32970336 AGGTGGGGGTGCACCTGACTCGG - Intergenic
952498028 3:33933169-33933191 GTTTGGGGGTGCAAGAGACAAGG + Intergenic
953008499 3:39000638-39000660 ATTTTGGGGTGCAACTGTTACGG + Intergenic
960363277 3:116740325-116740347 ATATTGGGGTCCAACAGACCTGG - Intronic
966572347 3:181459447-181459469 TTTTGGGGGTAAAACTCACCTGG + Intergenic
971271354 4:25149380-25149402 ATTTGGTGGTGCACCTGAAGAGG - Intronic
971969820 4:33606398-33606420 ATTAGAGAGTCCAACTGACCAGG + Intergenic
973800453 4:54472442-54472464 TTTTGGGAGTCCAAGTGACCTGG - Intergenic
974976626 4:68901687-68901709 TTGTGGGGGTGCACCTGACTCGG + Intergenic
974989026 4:69062213-69062235 TTGTGGGGGTGCACCTGACTTGG - Intronic
975624152 4:76326154-76326176 ATTTGGGGTTGGAACTGAAAAGG + Intronic
982151556 4:152463678-152463700 ATTTTGGGGTGCTAAGGACCTGG + Intronic
982205043 4:152991416-152991438 GTTTGGGGTTCCAACTGACTTGG - Intergenic
982503491 4:156189395-156189417 ATGTGGGGGTGAAACTGGCATGG + Intergenic
998594070 5:143509640-143509662 ATTTTAGAGTGCAAATGACCTGG + Intergenic
1001447645 5:171798193-171798215 CTTTGGGGGTCAAACAGACCTGG + Intergenic
1003136570 6:3439061-3439083 ATTTGGGGCCGGATCTGACCGGG + Intronic
1003978083 6:11363121-11363143 CTTTGGTGGTGCAACTGATTTGG + Intronic
1006267932 6:32940940-32940962 ATTTGGGGGGTCAAGGGACCCGG - Exonic
1006706745 6:36027395-36027417 ATTTGGGGGTTCAGGTGAGCAGG + Intergenic
1008078511 6:47170689-47170711 GTTTGGGGGCGCTACTGACATGG + Intergenic
1011649186 6:89490283-89490305 TTTTATGGGTGCAACTGACAGGG + Intronic
1017615629 6:156243844-156243866 ATTTGGGGGAGCCCGTGACCAGG - Intergenic
1018637729 6:165879079-165879101 ATTTGGGGGTGCAACTGACCTGG + Intronic
1026621732 7:71955556-71955578 ATTTTGGGGTTCAACAGACCTGG - Intronic
1034658820 7:152751367-152751389 ATTGGGGGGAGCAACAGAGCAGG - Intergenic
1035395458 7:158531942-158531964 ATTTGGGGTTTCCACTGACAAGG + Intronic
1036211042 8:6841572-6841594 ATGAGGGGGTGCAAGTGTCCAGG - Intergenic
1044799628 8:95940738-95940760 ATTTGGAGGTGCATCTAACAGGG + Intergenic
1050930899 9:11324777-11324799 ATTTGTGAGTGCAAATGTCCAGG + Intergenic
1054158919 9:61659934-61659956 GTTTGGGGGAGCAACTTGCCTGG - Intronic
1054449703 9:65397257-65397279 GTTTGGGGGAGCAACTTGCCTGG + Intergenic
1054478693 9:65590939-65590961 GTTTGGGGGAGCAACTTGCCTGG - Intergenic
1055650477 9:78402140-78402162 AGTTGGGGGTGCTAATGGCCAGG + Intergenic
1060903489 9:127282557-127282579 GTTTTGGGGCTCAACTGACCAGG - Intronic
1061213788 9:129208636-129208658 ATTTGAGGGTACATCTGCCCAGG + Intergenic
1186663379 X:11692675-11692697 TTTTGGGGGTGCAACTAAAGTGG - Intergenic
1187631802 X:21181427-21181449 ATGTGGGAGGTCAACTGACCTGG - Intergenic
1193722603 X:85004338-85004360 CATTTGGGGTGAAACTGACCAGG + Intronic
1194090906 X:89581217-89581239 TGGTGGGGGTGCATCTGACCTGG + Intergenic
1199531403 X:148851770-148851792 GTTTGGGGGTGCATGTGACACGG + Intronic
1200443557 Y:3237280-3237302 TGGTGGGGGTGCACCTGACCTGG + Intergenic