ID: 1018641873

View in Genome Browser
Species Human (GRCh38)
Location 6:165911478-165911500
Sequence CTGTGTAACCAGATGAAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 166}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018641873_1018641877 -8 Left 1018641873 6:165911478-165911500 CCAACTTTCATCTGGTTACACAG 0: 1
1: 0
2: 2
3: 19
4: 166
Right 1018641877 6:165911493-165911515 TTACACAGGCAGGTCTTGAAGGG 0: 1
1: 0
2: 0
3: 25
4: 199
1018641873_1018641876 -9 Left 1018641873 6:165911478-165911500 CCAACTTTCATCTGGTTACACAG 0: 1
1: 0
2: 2
3: 19
4: 166
Right 1018641876 6:165911492-165911514 GTTACACAGGCAGGTCTTGAAGG 0: 1
1: 0
2: 0
3: 23
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018641873 Original CRISPR CTGTGTAACCAGATGAAAGT TGG (reversed) Intronic
901447621 1:9317969-9317991 CTGTGGAACCAGAGGAAGCTGGG + Intronic
906150167 1:43582963-43582985 CTGTGTGGGCAGATGAAGGTTGG + Intronic
907789173 1:57645072-57645094 CTGTGGATCCAGATGAACCTTGG - Intronic
909309490 1:74128943-74128965 CTGTTTATCCAGGGGAAAGTAGG - Intronic
909335139 1:74464658-74464680 CTGTGTACACAGATGAGACTGGG - Intronic
911354216 1:96796486-96796508 TTGTTTAACAAGTTGAAAGTAGG + Intronic
915027475 1:152844228-152844250 CTGTGTTTACAGATGTAAGTGGG + Intergenic
915797811 1:158755317-158755339 CTTTGTATCCAGCTGACAGTTGG + Exonic
918066413 1:181105038-181105060 CTGTGCGGCCAGATGAAAGGGGG - Intergenic
919002250 1:191847599-191847621 CTGTCTAACCAGCCAAAAGTTGG + Intergenic
920657133 1:207885594-207885616 ATGTGCAACTAGATGCAAGTGGG + Intronic
924015735 1:239719691-239719713 CTGTTTAAATAGATAAAAGTGGG + Intronic
924291029 1:242536569-242536591 CTGTGTAACCTCGTGAAAATTGG - Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
924732885 1:246728147-246728169 CTGTGTAACAAGGTGAATGTTGG + Intronic
1064434155 10:15296143-15296165 CTGTGTAATCTGATGAAATTAGG + Intronic
1067818064 10:49498415-49498437 CTCTGGAACCAGATGAACTTGGG - Intronic
1067976350 10:51029862-51029884 CTGTGTAACCTGGGGCAAGTAGG + Intronic
1068132471 10:52911842-52911864 CTTTGTAAACAGATTAGAGTTGG - Intergenic
1068711661 10:60141518-60141540 CAGTGTACCCAGATGGAAGATGG - Intronic
1073959602 10:108911706-108911728 GTGTGTAAACAGATGAAAGATGG - Intergenic
1074301350 10:112235749-112235771 TTGTGTTACAAGATGAAAGAGGG - Intergenic
1076190343 10:128478910-128478932 CTGTGTAACCAGCTCAAGGCAGG - Intergenic
1076233061 10:128838114-128838136 CTGTGGAACCAGTGGAGAGTGGG - Intergenic
1077037804 11:503702-503724 CTCTGCAGCCAGATGAAAGGTGG + Intronic
1078572224 11:12469158-12469180 CTGTGGAACCTTATGTAAGTAGG - Intronic
1080731124 11:34954363-34954385 CTGTGTACACAGATGAGATTAGG + Intronic
1082742810 11:56929557-56929579 CTGTGTAATCTGAAGAAAGTTGG + Intergenic
1082873209 11:57962552-57962574 CTGTGTGATCAGAAGAAAATTGG - Intergenic
1087729854 11:101766843-101766865 TTGTGTAAGCAGATGAAAATAGG + Intronic
1089859666 11:121577590-121577612 CTGTTTAATCAGTTGAAAGCAGG - Intronic
1090213016 11:124936114-124936136 CTGTGTATTCAGAGGGAAGTTGG - Exonic
1090823349 11:130364813-130364835 CTCTGGAAACACATGAAAGTAGG - Intergenic
1091657652 12:2357281-2357303 CTCTGTTTCCTGATGAAAGTAGG + Intronic
1093179367 12:15949996-15950018 CAGTGTAATCAGGGGAAAGTAGG - Intronic
1095103660 12:38206875-38206897 CTGTGTAACCATGGGAAAGTGGG - Intergenic
1096444150 12:51673556-51673578 CTGGGCACCCAGAAGAAAGTTGG + Intronic
1099158874 12:79214626-79214648 CTGTGTAATCACTTGAAAGTAGG + Intronic
1100414803 12:94360800-94360822 CTGTGTAAAAAGAACAAAGTTGG + Intronic
1100657457 12:96661998-96662020 CTTGGTAACCAGTTGGAAGTGGG - Intronic
1104715643 12:131014369-131014391 GTGTGAAACCAGATCAAAGGCGG - Intronic
1112892493 13:104255403-104255425 CTGAGAAAACAGATGTAAGTAGG - Intergenic
1112950552 13:104990621-104990643 CTGTGTAACCTGATGAATTGTGG + Intergenic
1113731776 13:112646576-112646598 GTGAACAACCAGATGAAAGTGGG - Intergenic
1115805579 14:37047379-37047401 CTGTGAAACCAGACCAAAGTTGG + Intronic
1115829170 14:37315815-37315837 CTGTGGGACTAGATGAAACTGGG + Intronic
1120428987 14:84389834-84389856 CTGTGGGAACAGATGTAAGTTGG - Intergenic
1121038526 14:90726490-90726512 CTGACTTACCAGCTGAAAGTGGG - Intronic
1121827630 14:97023298-97023320 ATGTGTAAGCATAGGAAAGTCGG - Intergenic
1123504960 15:20932802-20932824 GTGTGTAACCATGAGAAAGTGGG - Intergenic
1123562205 15:21506496-21506518 GTGTGTAACCATGAGAAAGTGGG - Intergenic
1123598450 15:21943783-21943805 GTGTGTAACCATGAGAAAGTGGG - Intergenic
1124559213 15:30756496-30756518 CTGTGTTACCAGATCAAACTTGG + Intronic
1124672042 15:31649225-31649247 CTGTGTTACCAGATCAAAGTTGG - Intronic
1125065430 15:35479199-35479221 CTGTGTGACCAGAGGAAAACTGG + Intronic
1126347889 15:47716230-47716252 CTGTGTAACCCAAGGAAAGAAGG - Intronic
1128652201 15:69425557-69425579 CTGTATGACAAGATGAAGGTTGG - Intronic
1128713726 15:69891721-69891743 CTGGGTGATCACATGAAAGTAGG - Intergenic
1130764621 15:86857435-86857457 ATGTGAAAACAGATGAAAGAAGG - Intronic
1132103080 15:99041525-99041547 CTGGGTAACCAGATAGCAGTTGG + Intergenic
1202970550 15_KI270727v1_random:233638-233660 GTGTGTAACCATGAGAAAGTGGG - Intergenic
1133870281 16:9679621-9679643 CTGGGGAACCAGATGAAAGCAGG + Intergenic
1134879094 16:17728617-17728639 CTGTGTATACACATGAAAGAGGG + Intergenic
1137392045 16:48089548-48089570 CTGTGTAAACAGCTGGAAATAGG + Intronic
1137495374 16:48965313-48965335 CTGTGTAGACAGATGAAGGAGGG + Intergenic
1137611535 16:49821551-49821573 CTCTGTGACCAGATGAACGGAGG + Intronic
1139495315 16:67312680-67312702 CTGAGCAACCAGATGAATGGTGG - Intronic
1140521909 16:75588955-75588977 CTGTGAAGCCAGCTGACAGTGGG - Intergenic
1142868104 17:2803334-2803356 TTGCGTAACCAGATGACACTGGG - Intronic
1145306272 17:21676980-21677002 GTGTGTAACCAGAGGAATGTGGG + Intergenic
1146241277 17:31229322-31229344 GTGTGTAACCATGAGAAAGTGGG + Exonic
1149096328 17:52845272-52845294 CTGTGTAACCAGATGATCCTGGG + Intergenic
1150219743 17:63489304-63489326 ATGTGGCACCAGATGCAAGTGGG - Intronic
1150323183 17:64233751-64233773 CTGTGTAACTACATCAAAGAAGG + Intronic
1151053953 17:71010900-71010922 CTGTGTGACCTCATGTAAGTGGG + Intergenic
1151887552 17:76932130-76932152 CTGTGTAAGAAGAAGAAAGAAGG - Intronic
1154073534 18:11177414-11177436 CTGTGTACCCAGAACATAGTAGG + Intergenic
1158251584 18:55494320-55494342 CTGTGGAATCACATGAAAGGTGG + Intronic
1158452326 18:57578287-57578309 CTGTGTAACCTGAGGTTAGTTGG - Intronic
1158582223 18:58693686-58693708 CTGAGTAACCAGATGGATGGTGG + Intronic
1159150924 18:64522863-64522885 CTTTGATTCCAGATGAAAGTGGG + Intergenic
1163557038 19:17998770-17998792 CTGGGTACCAAGATGAATGTGGG + Exonic
1164230775 19:23286025-23286047 CTGTGGAACAAACTGAAAGTGGG + Intergenic
1164246764 19:23436912-23436934 CTGTGGAACAAATTGAAAGTGGG + Intergenic
1165281128 19:34798409-34798431 CTGTGGTACCAGATTAGAGTTGG - Intergenic
1165929796 19:39349795-39349817 CTGGGCAACAAGGTGAAAGTTGG - Intronic
1167133297 19:47601483-47601505 CTGAGTCACCAGATGAACCTAGG - Intergenic
925511192 2:4627027-4627049 CTGTGTTACCAGATGACAGGGGG + Intergenic
927304958 2:21560293-21560315 CTTTGTAAACAGTTGGAAGTTGG - Intergenic
928765658 2:34642205-34642227 CTGTGCAATCAGATGATGGTAGG - Intergenic
928926311 2:36583228-36583250 CTGTATAACCAGAAAAAAATAGG + Intronic
929132607 2:38593146-38593168 CTGTTTAACCATAGGAAAGACGG - Intronic
929484876 2:42344253-42344275 ATTTTTAACCAGATGAAGGTGGG - Intronic
929920920 2:46171072-46171094 CTGTGTCTCCAGCTGGAAGTGGG - Intronic
931786324 2:65622396-65622418 CTGTGCAACCAGCTGAATGCAGG + Intergenic
932002070 2:67894198-67894220 CTTTGTACCCAGATAAACGTGGG - Intergenic
932136658 2:69237012-69237034 CTGTGTAATCAGATGGAAAAAGG + Intronic
934037815 2:88103355-88103377 CTGTTTAACCCAATGAAACTGGG + Intronic
934038555 2:88108866-88108888 GTGTGTCACCTGATGAAAGAGGG + Intronic
935708585 2:105877555-105877577 CTGTGTCTCCAGATGGAAGAGGG - Intronic
936068400 2:109349355-109349377 CTGTGCAGCCAGATGACAATCGG - Intronic
936667145 2:114609836-114609858 CTGAGTTACCAGAGGACAGTGGG + Intronic
939180977 2:138802567-138802589 CTGTGTAACCTCATCAAACTGGG + Intergenic
940571008 2:155433129-155433151 CTGGGTAAACATCTGAAAGTTGG + Intergenic
942623892 2:177878097-177878119 CTGTGTGACCAGATGAATGTAGG + Intronic
942727890 2:179029574-179029596 CTGTGTATCCAGCTCAGAGTTGG - Intronic
943140169 2:183972464-183972486 CTGTGCAACCTGATGTAATTTGG - Intergenic
944123641 2:196269076-196269098 ATGTGAAACCAGGTGAAACTGGG + Intronic
946067258 2:216998639-216998661 CATTATAACCAGATGAAAGGGGG - Intergenic
946524697 2:220505873-220505895 CTTTGTAACCACATGAATTTGGG + Intergenic
947742567 2:232491287-232491309 CAGAGTAACCAGAGGAAAGAGGG - Intergenic
948341300 2:237254396-237254418 CACTGTAACCAGAGAAAAGTTGG + Intergenic
1171531511 20:25856441-25856463 GTGTGTAACCAGAGGAATGTGGG + Intronic
1171532926 20:25863940-25863962 GTGTGTAACCAGAGGAATGTGGG + Intronic
1173114431 20:40226940-40226962 ATGTGGAACTAGATTAAAGTAGG + Intergenic
1175671940 20:60910806-60910828 CTGTATAAAAAGAAGAAAGTTGG - Intergenic
1176050412 20:63116352-63116374 ATGGGTAACCGGCTGAAAGTTGG - Intergenic
1185046699 22:48532027-48532049 CTGTGCATCCAGAGGAAGGTGGG + Intronic
949258022 3:2073187-2073209 CTGTGTAAACACATGAAATATGG + Intergenic
950168748 3:10821467-10821489 AAGTGTAACCAGAGGAAAATGGG + Intronic
950298463 3:11852572-11852594 CTGTGTGACCTGGTGCAAGTTGG + Intergenic
955876691 3:63498115-63498137 GTGTGTAACCAGATGAGGATAGG + Intronic
956277633 3:67520318-67520340 CTGGGTATCCAGTTGAAAGTTGG - Intronic
956589875 3:70903424-70903446 CTGAATATCCAAATGAAAGTAGG - Intergenic
957253335 3:77803861-77803883 CTCTGTAACATGATGATAGTAGG - Intergenic
958018142 3:87966869-87966891 CTCTGTAGCCATATGAGAGTAGG - Intergenic
959244715 3:103850895-103850917 CTATATAACCAGGTGAAAGCAGG - Intergenic
960320329 3:116226916-116226938 CTTTGTAACAAGGTGAAAGCTGG + Intronic
961003265 3:123388306-123388328 CTGTATGACCAACTGAAAGTGGG + Intronic
963210678 3:142686294-142686316 CTGATTAAGCAGATGAAAATAGG - Exonic
964276151 3:155010950-155010972 GTGTGTAAGCAGATGGAAGGAGG - Intergenic
968847330 4:3052293-3052315 CTGTTTGGCCTGATGAAAGTTGG + Intergenic
973701297 4:53539880-53539902 CTCTGTAACCAGCTGCAATTAGG + Intronic
975866892 4:78733025-78733047 CAGTTAAACCAGATGACAGTTGG - Intergenic
976291909 4:83427596-83427618 CTGTGAAACCAGATCATAGGGGG + Exonic
976472684 4:85447892-85447914 CTGTGGGACCAGATTAAAGCTGG - Intergenic
977247596 4:94651609-94651631 CAGTCTAACCAGAGGCAAGTGGG - Intronic
978010323 4:103674406-103674428 CTGTGGAAATAGATGGAAGTAGG + Intronic
982054124 4:151530379-151530401 TTGGGTAACTAGATGAAAGTGGG + Intronic
982103279 4:151989523-151989545 CTGTGTAACCACAGGGAAGCAGG - Intergenic
982217797 4:153097232-153097254 CTGTGCAACAAGGTGAAACTAGG - Intergenic
984669664 4:182467974-182467996 CTGTGCAACCTGAGGAAAGGAGG - Intronic
986957229 5:13167608-13167630 GTATGTTACCAGAGGAAAGTTGG + Intergenic
987833559 5:23131078-23131100 CTGTGTAACCTTATAAAAGATGG + Intergenic
990879482 5:60523392-60523414 CTGTGTTAGCCGGTGAAAGTTGG - Intergenic
994177325 5:96725090-96725112 CTGTGAAACTGGAGGAAAGTAGG + Intronic
996993301 5:129663569-129663591 CTTAGTAACCAAAAGAAAGTGGG - Intronic
998674556 5:144392502-144392524 CTGTGTGACCAGATGAGAGGTGG + Intronic
999001117 5:147923653-147923675 CTCTGAAATCAGACGAAAGTTGG + Intergenic
999821167 5:155230315-155230337 CTGTGTACACAGATGATTGTAGG + Intergenic
1005107854 6:22244865-22244887 CAGTGTAACAAGATGACACTGGG + Intergenic
1005805227 6:29468320-29468342 CTGTGGAGCCAGAGGAAAGGAGG - Intergenic
1008119019 6:47588944-47588966 CAGTGTAATCATATGAAAGTAGG + Intronic
1009051636 6:58283173-58283195 CTGTGAAAGCAGATGTAAATGGG + Intergenic
1014444010 6:121505485-121505507 GGTTGTAACCTGATGAAAGTAGG - Intergenic
1016315740 6:142784608-142784630 GTCAGTAACCAGATGAATGTGGG + Intronic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1018537117 6:164832760-164832782 GTGTGTCATCAGATGAAGGTGGG - Intergenic
1018641873 6:165911478-165911500 CTGTGTAACCAGATGAAAGTTGG - Intronic
1020184334 7:5947411-5947433 CTGTAAAAACAGATGAAGGTAGG + Intronic
1020298583 7:6777355-6777377 CTGTAAAAACAGATGAAGGTAGG - Intronic
1022620844 7:31983191-31983213 CTGTGTAACCAGGAGTAATTGGG - Intronic
1025284210 7:57649384-57649406 GTGTGTAAACAGAGGAATGTGGG + Intergenic
1026443733 7:70465827-70465849 CTGTGTACCCCCATGCAAGTGGG + Intronic
1028220638 7:88192177-88192199 CAGTGTAACCAGTTCAATGTGGG + Intronic
1028350659 7:89843102-89843124 ATGTATAACCAGATGAAAAAGGG - Intergenic
1029506278 7:100965777-100965799 CTGTGTCACCAAATGCACGTCGG + Exonic
1031252036 7:119396437-119396459 CTATTTAAGCAGATGAATGTTGG - Intergenic
1031684806 7:124720450-124720472 CTGTGTAAACAAATGTAAGGTGG - Intergenic
1038673490 8:29601506-29601528 CTGGGTAACTTGATGAAAGAGGG - Intergenic
1040884079 8:52240464-52240486 CTGTTAAACCAGAAGAAAGAAGG - Intronic
1042513756 8:69638306-69638328 CTGTGAAACTAGGTGAAAATGGG - Intronic
1043000327 8:74751839-74751861 CTGTATAAACAGATGACTGTAGG + Intronic
1043465531 8:80502825-80502847 CTATGTAAACAAATGAAGGTAGG + Intronic
1043813812 8:84776901-84776923 TTGTGTAAACAGATAAAAGGAGG - Intronic
1044359002 8:91259501-91259523 CTGTGCAATGAGAGGAAAGTTGG - Intronic
1044496251 8:92888086-92888108 CTGTGTAACCAGATGGGTCTGGG - Intronic
1047334834 8:123925528-123925550 CTGTGTGCCCAGCTGAAAATTGG + Intronic
1048919268 8:139213225-139213247 CTGTGTTATGAGATGAAAGAAGG - Intergenic
1051433750 9:17007857-17007879 CTGTATAACCAGCTGAAGGAGGG + Intergenic
1051681584 9:19612949-19612971 CTTTGGAACCAGATCAATGTCGG + Intronic
1059890040 9:118791543-118791565 TTTTGTAACCAGTTGAAAGATGG + Intergenic
1189081311 X:37975560-37975582 CTTTTGAACCTGATGAAAGTTGG + Intronic
1192218927 X:69183601-69183623 TTGTGTAACTAGATGTAAGGGGG - Intergenic
1192403007 X:70855746-70855768 CTTTATAACCAGAGGAAATTTGG + Intronic
1197316814 X:124976760-124976782 CTACATAACCAGATGAAAGAGGG + Intergenic
1198913355 X:141638238-141638260 CTGTGAAAGCAGCTGAGAGTGGG - Intronic
1200022167 X:153221227-153221249 TTGTCTACCAAGATGAAAGTGGG + Intergenic