ID: 1018641939

View in Genome Browser
Species Human (GRCh38)
Location 6:165911850-165911872
Sequence GCTTCCTCCGGACAGCACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 103}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018641939_1018641946 12 Left 1018641939 6:165911850-165911872 CCAAGGTGCTGTCCGGAGGAAGC 0: 1
1: 0
2: 2
3: 10
4: 103
Right 1018641946 6:165911885-165911907 GGAAGTGTGCGTTTTCCTCTGGG 0: 1
1: 1
2: 2
3: 12
4: 180
1018641939_1018641945 11 Left 1018641939 6:165911850-165911872 CCAAGGTGCTGTCCGGAGGAAGC 0: 1
1: 0
2: 2
3: 10
4: 103
Right 1018641945 6:165911884-165911906 AGGAAGTGTGCGTTTTCCTCTGG No data
1018641939_1018641947 18 Left 1018641939 6:165911850-165911872 CCAAGGTGCTGTCCGGAGGAAGC 0: 1
1: 0
2: 2
3: 10
4: 103
Right 1018641947 6:165911891-165911913 GTGCGTTTTCCTCTGGGAGACGG 0: 1
1: 0
2: 1
3: 16
4: 176
1018641939_1018641943 -9 Left 1018641939 6:165911850-165911872 CCAAGGTGCTGTCCGGAGGAAGC 0: 1
1: 0
2: 2
3: 10
4: 103
Right 1018641943 6:165911864-165911886 GGAGGAAGCTTTTGAGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018641939 Original CRISPR GCTTCCTCCGGACAGCACCT TGG (reversed) Intronic