ID: 1018642738

View in Genome Browser
Species Human (GRCh38)
Location 6:165919380-165919402
Sequence CAAGGTTATCCCCTAGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 52}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018642738_1018642742 3 Left 1018642738 6:165919380-165919402 CCTCCATCTAGGGGATAACCTTG 0: 1
1: 0
2: 0
3: 6
4: 52
Right 1018642742 6:165919406-165919428 CTTAGTTAATAGCAAGATCTTGG 0: 1
1: 0
2: 1
3: 6
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018642738 Original CRISPR CAAGGTTATCCCCTAGATGG AGG (reversed) Intronic
1068325488 10:55480570-55480592 CATGGTTATCTCATAGATGCAGG - Intronic
1070942686 10:80360330-80360352 CAAGGGTATCCTCTAGAAGCTGG - Intronic
1075378803 10:122001322-122001344 CAAGGTTATGTCTTACATGGTGG + Intronic
1077956151 11:7021549-7021571 CATTGTTATCCACTAGGTGGTGG + Intronic
1085801877 11:79597872-79597894 CAGGGTTCTCACCTATATGGTGG - Intergenic
1100103500 12:91139725-91139747 CAAAGTTATCTACTAGAGGGAGG + Intergenic
1103351598 12:120287470-120287492 CAAGGATATTACCTACATGGTGG + Intergenic
1107957784 13:45533135-45533157 CAAGGTCATCACCGAGAGGGAGG + Intronic
1108540742 13:51442541-51442563 CTGGTTTATCCCCTAGATCGGGG + Intronic
1110303067 13:73951992-73952014 CAAGCTTATCTCCTAGATCCTGG - Intronic
1111750442 13:92324332-92324354 CAATGTTAACCCCCAAATGGTGG + Intronic
1117783198 14:59256010-59256032 CAAGGTTTTCCTCTAGCTAGAGG - Intronic
1118368530 14:65116028-65116050 CAAGGTTATCCCCCAGATCCAGG - Intergenic
1119051615 14:71375213-71375235 CAAGAGAATCCCCAAGATGGTGG - Intronic
1124686107 15:31783286-31783308 AAAGGTAAGCCCCTAGACGGGGG - Intronic
1126423388 15:48499398-48499420 CAAAATTATCCCCAAGATGGTGG - Intronic
1129110360 15:73333601-73333623 CAGGGTCATGCCCTTGATGGGGG - Intronic
1129312181 15:74720534-74720556 CATGGTTAGCCCATAGATGGGGG + Exonic
1129317638 15:74755012-74755034 CATGGTCAGCCCGTAGATGGGGG - Exonic
1134901919 16:17946040-17946062 GAAGGATATCCCCCATATGGAGG + Intergenic
1138194872 16:55044638-55044660 GAGGGATATACCCTAGATGGAGG - Intergenic
1140237118 16:73169738-73169760 CAAGGTTATGCCCAGTATGGTGG + Intergenic
1140928457 16:79605286-79605308 CAAGGGTATCATTTAGATGGGGG + Intergenic
1146929467 17:36767551-36767573 CAAGGTTACTCCCTAGATCAGGG - Intergenic
1150519520 17:65852016-65852038 CAAGGTTATTGCCGACATGGAGG - Exonic
1151990217 17:77569994-77570016 CCAGCTTATTCCCTAGGTGGAGG - Intergenic
1165732028 19:38152089-38152111 TAAAGTTATCCCCTAGACAGAGG - Intronic
925059749 2:881672-881694 CAGGGTTCTCCCCTCGAAGGGGG - Intergenic
938488054 2:131735133-131735155 ATAGGTTGTCCCCTAGATCGGGG + Intronic
939718814 2:145621177-145621199 CAAGGATAACCCCTAGATGATGG - Intergenic
946121345 2:217517789-217517811 TAAGGTTAACACCTCGATGGGGG - Intronic
1179492916 21:41752888-41752910 CTAGGTGATAACCTAGATGGTGG + Intronic
956217072 3:66859654-66859676 CAAGGTTATCCACTAGAAAGTGG + Intergenic
957952051 3:87140262-87140284 TGAGTTTATCCCCTAGATGGAGG - Intergenic
966435662 3:179881162-179881184 CAAGCTTTTCCTCTAGGTGGGGG + Intronic
976898994 4:90150058-90150080 TGTGGTTATCCCCTATATGGAGG - Intronic
981456071 4:144954416-144954438 CAAGTTTCTCCCCCAGTTGGAGG + Intergenic
988037833 5:25851255-25851277 CAAGATTTTCTCATAGATGGTGG - Intergenic
990701182 5:58476421-58476443 CAAAGTCATCTCCTACATGGTGG + Intergenic
991772319 5:70051576-70051598 CAAGGTTATCAGCTAGAAGCTGG + Intronic
991851612 5:70926994-70927016 CAAGGTTATCAGCTAGAAGCTGG + Intronic
1002810098 6:620421-620443 CAAAGTAAACCCCAAGATGGTGG - Intronic
1003607728 6:7579846-7579868 CATGGATATCTCCTTGATGGTGG - Exonic
1004724965 6:18302492-18302514 CAAGGTCATCACTTAGCTGGTGG + Intergenic
1016464251 6:144309911-144309933 CAAGGTTATCTGCTAGAAGAGGG - Intronic
1018642738 6:165919380-165919402 CAAGGTTATCCCCTAGATGGAGG - Intronic
1018863525 6:167730633-167730655 CAAGGCTGTGCCCTGGATGGTGG + Intergenic
1019243971 6:170694437-170694459 CAAGGTCATACCATACATGGAGG - Intergenic
1030798382 7:113818016-113818038 CAAGGCTATCCCTTCAATGGAGG + Intergenic
1038535141 8:28348397-28348419 CAAGCTAATCCCCTAGAGAGTGG + Exonic
1039461592 8:37749943-37749965 CTCGGTTATCCCCTTGCTGGAGG + Intronic
1052488096 9:29128260-29128282 AAAGGGGATGCCCTAGATGGAGG + Intergenic
1056090868 9:83204231-83204253 CAGGGTTGGCCACTAGATGGAGG + Intergenic
1059446639 9:114342248-114342270 CAATGTCATCACCCAGATGGAGG - Intronic
1059952592 9:119481887-119481909 CAAGGATAACATCTAGATGGTGG + Intergenic
1060611020 9:124964608-124964630 CAATGTCAGCCTCTAGATGGGGG - Intronic
1186390590 X:9154785-9154807 CAAGGTTAACTCCAATATGGTGG - Intronic
1199552094 X:149071516-149071538 CAAGGTCATGCCATATATGGTGG + Intergenic
1200764031 Y:7065328-7065350 CAAAGTTATGCCTTACATGGTGG - Intronic