ID: 1018645941

View in Genome Browser
Species Human (GRCh38)
Location 6:165948636-165948658
Sequence TCACCTCGATGGTTTCTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 73}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018645941_1018645945 13 Left 1018645941 6:165948636-165948658 CCATCAAGAAACCATCGAGGTGA 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1018645945 6:165948672-165948694 TTCAGAGCCAAGATTGCTGTGGG 0: 1
1: 1
2: 2
3: 12
4: 180
1018645941_1018645946 16 Left 1018645941 6:165948636-165948658 CCATCAAGAAACCATCGAGGTGA 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1018645946 6:165948675-165948697 AGAGCCAAGATTGCTGTGGGTGG 0: 1
1: 0
2: 1
3: 14
4: 176
1018645941_1018645944 12 Left 1018645941 6:165948636-165948658 CCATCAAGAAACCATCGAGGTGA 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1018645944 6:165948671-165948693 TTTCAGAGCCAAGATTGCTGTGG 0: 1
1: 0
2: 0
3: 18
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018645941 Original CRISPR TCACCTCGATGGTTTCTTGA TGG (reversed) Intronic
909258183 1:73451137-73451159 TCAACTCCAGGCTTTCTTGATGG + Intergenic
916155912 1:161847612-161847634 TCACCTTGATGATCTCTTAACGG + Intronic
918375003 1:183900218-183900240 TCACCTCGATGTAGTCCTGAAGG - Exonic
919675696 1:200380538-200380560 CCACCTGGCTGGTTTCTTTAGGG - Intergenic
920058229 1:203208232-203208254 TCAGCTCGATGCTTTTTTTAAGG - Intergenic
1063322310 10:5061623-5061645 TCAGCTCTGGGGTTTCTTGAAGG - Intronic
1072007797 10:91271727-91271749 TCACCGCCATGGTGTCATGATGG - Intronic
1074485470 10:113873185-113873207 TAACCTTGATTGATTCTTGAAGG - Intronic
1078186847 11:9059059-9059081 TCACATCGATGGGTTCTTTAAGG + Intronic
1081684282 11:45030600-45030622 TCACCTAGAGGGCTTGTTGAAGG - Intergenic
1083705566 11:64511990-64512012 TCATCTCTATGGTTTGCTGAAGG + Intergenic
1087017352 11:93566894-93566916 TTACTTCAATAGTTTCTTGAGGG - Intergenic
1088081858 11:105926813-105926835 TAACCTCGCTGCTTTCCTGACGG + Exonic
1094676410 12:32624978-32625000 AAGCATCGATGGTTTCTTGAAGG - Exonic
1098651369 12:72974678-72974700 CCAACTCTATGCTTTCTTGATGG - Intergenic
1099398792 12:82176598-82176620 TGACCTACATGGTTTATTGATGG + Intergenic
1103031632 12:117619072-117619094 TCTCCTAGAAGGTTTCTTGAAGG - Intronic
1103262841 12:119603484-119603506 TCACCTTGATGATTATTTGAAGG - Intronic
1109168674 13:59068145-59068167 TTACTTGGATGTTTTCTTGATGG + Intergenic
1110392951 13:74996630-74996652 TCACCACGATGGTTGGTTGATGG + Intergenic
1111571600 13:90094677-90094699 TCAAATCCATGGTTTCTTCATGG - Intergenic
1113590100 13:111492713-111492735 TCACCTTGCTGGTCTCTTAAAGG - Intergenic
1116520999 14:45847060-45847082 TCACTTTGAAGGTTTCTTAAGGG - Intergenic
1122219591 14:100228098-100228120 TCCCCTAGGTGGTTTCTAGAAGG + Intergenic
1128610404 15:69068422-69068444 TCACTTCGCTGGTGCCTTGAGGG + Intergenic
1129626956 15:77211422-77211444 TCACCTCCATGGTATCTTAGTGG - Intronic
1129731447 15:77934854-77934876 TGGCCTCTATGGTTTCTTTAGGG - Intergenic
1142190471 16:88714979-88715001 TCACCTCGTGGGTGGCTTGAGGG + Intronic
1145354207 17:22123640-22123662 TAACTTCGTTGGATTCTTGAAGG - Intergenic
1150265833 17:63831947-63831969 TCACTTCCATAATTTCTTGATGG - Exonic
1151654387 17:75488992-75489014 TCATCTCGAGGTTCTCTTGAGGG + Intronic
1159050270 18:63415314-63415336 GCACTTCCATAGTTTCTTGATGG + Intronic
1166687878 19:44807026-44807048 TCAGCTGGCTGGGTTCTTGAGGG + Intergenic
1167344979 19:48939633-48939655 TCACCTCCATGGTCTTTGGAGGG + Exonic
930694701 2:54399718-54399740 TCACACAGAAGGTTTCTTGAGGG - Intergenic
935952857 2:108346597-108346619 TCACCAAGATGTTTTCCTGATGG - Intergenic
948811676 2:240481587-240481609 TCACCTCGATGGGTTGCTCAGGG + Intronic
1173105628 20:40130932-40130954 TCACATCGATGGTGACCTGAGGG + Intergenic
1179571149 21:42279576-42279598 TGAACTGGATGGTTTCTTTAAGG + Intronic
1181577006 22:23801576-23801598 TCGCCTCGATGGCCTCTGGAGGG - Intronic
951034751 3:17920842-17920864 TAAATTTGATGGTTTCTTGAGGG + Intronic
952502569 3:33977763-33977785 TCACCTCCAAGTGTTCTTGATGG - Intergenic
952874938 3:37936718-37936740 TCAACTCTATGATTTCTTTAAGG + Intronic
953015461 3:39071453-39071475 TCATCTCCATGGTTTCCAGAAGG + Intronic
960818326 3:121697813-121697835 TCTCCTCGATGGTTTGTTGGAGG + Exonic
961203938 3:125066152-125066174 TCACCCGGATGGTTTCTACAAGG + Intergenic
965377582 3:167944680-167944702 TGACTTCTATGGTTTCTTGTTGG - Intergenic
966096372 3:176208602-176208624 TCATCTGGATGGTTTGTTCAAGG + Intergenic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
970005244 4:11404665-11404687 TTACCTGGTTTGTTTCTTGAGGG - Intronic
970922162 4:21407292-21407314 TAACCTGGATGGTTTATTTATGG - Intronic
984406339 4:179336399-179336421 TAATCTCCATGGTTTGTTGATGG - Intergenic
984885026 4:184442315-184442337 TCACCTCCATGCTCTCTTTAAGG + Intronic
986000402 5:3626749-3626771 TGACCTTGATGTGTTCTTGAGGG - Intergenic
986489837 5:8278070-8278092 TCACCTCAATTGTTTCTTCACGG - Intergenic
1008343513 6:50397197-50397219 TAATCTCCATGATTTCTTGATGG + Intergenic
1010309022 6:74360722-74360744 CCATCACTATGGTTTCTTGAAGG - Intergenic
1011586397 6:88930922-88930944 TTACTTGGATGGTTTCTTTATGG - Intronic
1012054894 6:94393823-94393845 TCACCTCCAAGGGTTCCTGATGG - Intergenic
1015631623 6:135237321-135237343 GCACCATGAGGGTTTCTTGATGG + Intergenic
1018645941 6:165948636-165948658 TCACCTCGATGGTTTCTTGATGG - Intronic
1022434811 7:30372721-30372743 TCAATTCCATAGTTTCTTGATGG - Intronic
1031120267 7:117714099-117714121 TCACCTCCATGTGTACTTGATGG + Intronic
1031682501 7:124691831-124691853 TGACATTGTTGGTTTCTTGAGGG - Intergenic
1031959627 7:127976913-127976935 TCCCCTACATGGTGTCTTGAGGG + Intronic
1035931140 8:3781614-3781636 TCAACTATAGGGTTTCTTGATGG - Intronic
1039599822 8:38826595-38826617 TCATTTGGATAGTTTCTTGATGG + Intronic
1041790590 8:61692581-61692603 TCACCTGGAAGGTTTTTGGAGGG - Intronic
1041844347 8:62310788-62310810 TCACCTCGCTGGTTGATTCAGGG - Intronic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1047886473 8:129255488-129255510 TCACCTGGATGCTTTGATGAAGG + Intergenic
1058528276 9:105881780-105881802 TCAGTTGGTTGGTTTCTTGAGGG - Intergenic
1058805029 9:108582236-108582258 TCACCTCCAGGGGTTTTTGAGGG - Intergenic
1060962156 9:127688813-127688835 TCACCTACGTGGTTTCTTTAAGG - Intronic
1185789045 X:2914658-2914680 TCCTCTCCAGGGTTTCTTGAAGG + Intronic
1194454340 X:94083405-94083427 TCACCTCAAAGTTTTCTTTAAGG + Intergenic
1196324932 X:114391370-114391392 TCAACACGATGGCTTCTGGAGGG - Intergenic
1198362776 X:135912396-135912418 TCACCTTGCTGCTTCCTTGATGG - Exonic
1201285936 Y:12378709-12378731 TCCTCTCCATGGTTTCCTGAAGG - Intergenic