ID: 1018645941

View in Genome Browser
Species Human (GRCh38)
Location 6:165948636-165948658
Sequence TCACCTCGATGGTTTCTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 73}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018645941_1018645946 16 Left 1018645941 6:165948636-165948658 CCATCAAGAAACCATCGAGGTGA 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1018645946 6:165948675-165948697 AGAGCCAAGATTGCTGTGGGTGG 0: 1
1: 0
2: 1
3: 14
4: 176
1018645941_1018645945 13 Left 1018645941 6:165948636-165948658 CCATCAAGAAACCATCGAGGTGA 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1018645945 6:165948672-165948694 TTCAGAGCCAAGATTGCTGTGGG 0: 1
1: 1
2: 2
3: 12
4: 180
1018645941_1018645944 12 Left 1018645941 6:165948636-165948658 CCATCAAGAAACCATCGAGGTGA 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1018645944 6:165948671-165948693 TTTCAGAGCCAAGATTGCTGTGG 0: 1
1: 0
2: 0
3: 18
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018645941 Original CRISPR TCACCTCGATGGTTTCTTGA TGG (reversed) Intronic