ID: 1018645944

View in Genome Browser
Species Human (GRCh38)
Location 6:165948671-165948693
Sequence TTTCAGAGCCAAGATTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 210}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018645940_1018645944 13 Left 1018645940 6:165948635-165948657 CCCATCAAGAAACCATCGAGGTG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1018645944 6:165948671-165948693 TTTCAGAGCCAAGATTGCTGTGG 0: 1
1: 0
2: 0
3: 18
4: 210
1018645943_1018645944 1 Left 1018645943 6:165948647-165948669 CCATCGAGGTGAGAAACAAGGTG 0: 1
1: 0
2: 0
3: 15
4: 135
Right 1018645944 6:165948671-165948693 TTTCAGAGCCAAGATTGCTGTGG 0: 1
1: 0
2: 0
3: 18
4: 210
1018645941_1018645944 12 Left 1018645941 6:165948636-165948658 CCATCAAGAAACCATCGAGGTGA 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1018645944 6:165948671-165948693 TTTCAGAGCCAAGATTGCTGTGG 0: 1
1: 0
2: 0
3: 18
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018645944 Original CRISPR TTTCAGAGCCAAGATTGCTG TGG Intronic
901725998 1:11242550-11242572 TTTATTAGCGAAGATTGCTGTGG - Intronic
904701108 1:32358690-32358712 TTTCAGAGCATAGAATGCAGGGG - Intronic
907340379 1:53731230-53731252 TTCCAGACCCCAGATTCCTGAGG + Intronic
908183845 1:61632859-61632881 TTACAGAGCCAGAGTTGCTGTGG - Intergenic
908342766 1:63198946-63198968 ATTCAGAGGCAAGTCTGCTGAGG - Intergenic
909799532 1:79788700-79788722 GTTCAGAACTAAGATTTCTGAGG + Intergenic
911069094 1:93817906-93817928 TGGCAGAGCCAAGAGGGCTGAGG - Intronic
911597782 1:99816533-99816555 CTTCAGAGACAAAATTACTGGGG - Intergenic
912856997 1:113178159-113178181 CTTCTGTGCCCAGATTGCTGGGG - Intergenic
914905465 1:151740102-151740124 AGTCAGTGCCAAGAGTGCTGAGG + Intergenic
915097145 1:153471139-153471161 TTTCAGAACCAAGAGTTGTGGGG + Intergenic
915097900 1:153476676-153476698 TTTCAGAGCAGAGTCTGCTGGGG + Intergenic
917486944 1:175463978-175464000 GTTCAGATTCAAGAATGCTGAGG - Intronic
918104845 1:181407982-181408004 GTACAGAGCCAAGATAGCTCAGG + Intergenic
918305274 1:183240318-183240340 TACCAGAGCCAAGAACGCTGGGG + Exonic
920014015 1:202891215-202891237 TTTCAGAGCAAAGGTTGTTTAGG + Exonic
921300681 1:213748952-213748974 TTTCATAGCCAACACTGCGGAGG - Intergenic
922352777 1:224747979-224748001 TTTCATATCCAACATTTCTGAGG + Intergenic
922637250 1:227186401-227186423 TTTCAGAGCCTAACCTGCTGGGG + Intronic
924603039 1:245508061-245508083 TTTCTGAGCCATGATTCCTCAGG + Intronic
1063433434 10:6011262-6011284 TTCCAGAGCTAAGATTTCGGTGG - Exonic
1064853023 10:19731933-19731955 TTTAAGAGCCTTGAGTGCTGTGG + Intronic
1067469446 10:46525353-46525375 TTACAGCTCTAAGATTGCTGAGG + Intergenic
1068776397 10:60872690-60872712 TGTCAGAGCTCAGCTTGCTGGGG + Intronic
1069194235 10:65528475-65528497 TTTCAATGCCAAGTTTTCTGAGG - Intergenic
1070040490 10:72773308-72773330 TTTCATTTCCAAGATTTCTGTGG - Intronic
1072516507 10:96188484-96188506 TTATAGAGCCAGGGTTGCTGTGG + Intronic
1073705331 10:105976938-105976960 TTTCTGTGCCTAGTTTGCTGAGG + Intergenic
1074182107 10:111074690-111074712 TTTCAGAGCCAGGAACCCTGAGG - Intergenic
1076927219 10:133497874-133497896 TTTCAAAGTCACAATTGCTGTGG - Intergenic
1077241132 11:1510638-1510660 GGTCAGAGCCAGGCTTGCTGGGG + Intergenic
1078126156 11:8565551-8565573 TTTCACAGACAAGATGACTGAGG - Intronic
1078886963 11:15510029-15510051 TTTCAGTGTAAATATTGCTGAGG + Intergenic
1078900035 11:15633360-15633382 TTTGATAACCAAGAATGCTGAGG + Intergenic
1079740504 11:24053233-24053255 TTTCAGAGATAAGCGTGCTGAGG - Intergenic
1080126923 11:28745849-28745871 TTGCATAACCAAGACTGCTGAGG + Intergenic
1080327294 11:31091433-31091455 TATCAGAGTCAAGGCTGCTGAGG - Intronic
1080805011 11:35644851-35644873 TTTAAGAGCCAAAATTGTTTGGG - Intergenic
1080927784 11:36776224-36776246 TTTCAGAGCCATGAGGTCTGGGG + Intergenic
1081236557 11:40654092-40654114 GTCCAGAGACAAGTTTGCTGAGG + Intronic
1081656419 11:44860651-44860673 GATCTGAGCCAAGGTTGCTGGGG + Intronic
1081820878 11:45993562-45993584 TTTCTGAGCCAACTTTTCTGGGG + Intronic
1084904543 11:72335519-72335541 TTTCAGAACCAAGATGGAAGTGG - Intronic
1085082291 11:73645251-73645273 TCTCACAGCCAGGACTGCTGCGG + Intergenic
1085699437 11:78733100-78733122 AATTAGAGCTAAGATTGCTGTGG - Intronic
1085752214 11:79171372-79171394 TTTCAGAGCCAGGATGAGTGAGG + Intronic
1087674644 11:101146186-101146208 TTTCAGTGTCAAGTTTCCTGAGG - Intergenic
1088532037 11:110820964-110820986 TTTCAGAGTCAGCCTTGCTGGGG + Intergenic
1088922339 11:114269664-114269686 TTTCACAGCCAAGCTTTCAGAGG + Intronic
1089030226 11:115319040-115319062 TTTTATAGACAAGAATGCTGAGG + Intronic
1091397440 12:162703-162725 TTTGAGAGCCTTTATTGCTGAGG + Intronic
1091967688 12:4759074-4759096 GTTAAAAGTCAAGATTGCTGAGG - Intronic
1093646707 12:21594365-21594387 TTTCAGCGCTAAGAGTGCTTTGG - Intronic
1094082786 12:26555752-26555774 ATTCAGAGAGGAGATTGCTGAGG - Intronic
1095601216 12:44015014-44015036 TTTCTGAACCAAGTTTGCTAAGG - Intronic
1096042810 12:48533719-48533741 CTTCAAAGCCTAGTTTGCTGAGG - Intergenic
1097060857 12:56282592-56282614 TTTGAGAGCCAAGATACCTGTGG + Exonic
1098656106 12:73031748-73031770 TTTGAGAACCATGATGGCTGTGG - Intergenic
1104619287 12:130298745-130298767 CTTCACAGCCAAGAGTGGTGGGG - Intergenic
1104632511 12:130415370-130415392 TTTCAATGCCTAGATTGTTGAGG - Intronic
1107097338 13:36550716-36550738 TGTCAGAGCCAAGATTCCCAAGG - Intergenic
1107553089 13:41494937-41494959 TTTCAGAGACAAGAAAACTGAGG + Intergenic
1107583202 13:41814869-41814891 TTTCAGTTCCAGGATTGCAGGGG - Intronic
1110100423 13:71594652-71594674 TTTCAGTGCAAAGATTTTTGAGG + Intronic
1110137768 13:72089511-72089533 GTTCATACCCTAGATTGCTGTGG + Intergenic
1110272933 13:73611190-73611212 TCTCAAAGCCAGGATTGCTGGGG + Intergenic
1111452226 13:88434337-88434359 TTTCAAAACCAAGATTTTTGTGG + Intergenic
1113010287 13:105757398-105757420 TTTCAAAGCAAAGTTTGCTGGGG - Intergenic
1115349845 14:32382042-32382064 TTTCACAGATAAGATTACTGAGG - Intronic
1116211207 14:41947268-41947290 TTTCAGATGCAAGATTCCTCAGG + Intergenic
1118862232 14:69673447-69673469 TTTCAGAGCAAATTTTGCTGAGG + Intronic
1120739311 14:88090189-88090211 TTTCAGATCCAAGATTTATTTGG + Intergenic
1120868299 14:89314992-89315014 TTTCTGAGACATGATTACTGGGG - Intronic
1121357763 14:93230211-93230233 GTTCAGAGGCCAGATTGCAGAGG + Intergenic
1122189471 14:100029305-100029327 TTTCAGAACCAACATAGTTGAGG - Intronic
1122500946 14:102199149-102199171 CTTCACAGCCCAGAATGCTGAGG + Intronic
1122842981 14:104475788-104475810 TTTCATAGCCGAGGATGCTGAGG - Intronic
1122907221 14:104807392-104807414 TTTCACAGGCGAGAATGCTGAGG - Intergenic
1123766889 15:23490163-23490185 TTCCCCTGCCAAGATTGCTGGGG + Intergenic
1131070006 15:89460259-89460281 TTTCACAGACAAGACTACTGAGG - Intergenic
1131303013 15:91216337-91216359 GTTCCCAGCTAAGATTGCTGGGG - Intronic
1131618217 15:94038878-94038900 CTTCAGTGCCTAGTTTGCTGAGG - Intergenic
1134794606 16:17023552-17023574 TTTCAGAGATAAACTTGCTGAGG - Intergenic
1135066808 16:19317033-19317055 TGTCAAAGCCAAGACTTCTGGGG + Intronic
1135951640 16:26919817-26919839 TTTGAGAGCCAGAATTACTGCGG + Intergenic
1136639789 16:31553708-31553730 TTTGAGAACCAGGAGTGCTGAGG - Intergenic
1136664975 16:31802800-31802822 TTTGAGAACCAGGAGTGCTGAGG + Intergenic
1136991280 16:35152688-35152710 TTGCTGAGACGAGATTGCTGGGG + Intergenic
1137548226 16:49418610-49418632 TTTCACACCCAAGATCACTGTGG + Intergenic
1138470103 16:57227804-57227826 TTTCAGGGACAAGATGGCTATGG + Intronic
1141300775 16:82813624-82813646 ATACAGACCCCAGATTGCTGGGG + Intronic
1145367795 17:22278996-22279018 TTTCAGCCCCAAGACTTCTGCGG - Intergenic
1147736643 17:42642903-42642925 TTTGAGAGCCAAGGTCCCTGAGG - Intergenic
1148381809 17:47205231-47205253 TTTCTGAGCCAGAGTTGCTGAGG - Intronic
1149062595 17:52440732-52440754 TTTCAGTGCCTAGTTTGTTGAGG - Intergenic
1153559604 18:6358718-6358740 TTGAAGAGCCAAGTTTCCTGAGG - Intronic
1156131454 18:33980493-33980515 TACCAGAGCCTAAATTGCTGTGG + Intronic
1156252664 18:35365916-35365938 TTTCAGAGGTGAGAATGCTGAGG + Intergenic
1157782750 18:50454556-50454578 ACTCAGAGCCAAGACTGCTCTGG - Intergenic
1158523787 18:58194490-58194512 TTTAAGAGCCAAGAGTGTTGAGG - Intronic
1164416479 19:28050166-28050188 TTTCACAGCCATCCTTGCTGTGG - Intergenic
1165683446 19:37797247-37797269 TTTCAAAGCCACGATTTATGGGG + Intronic
1167024956 19:46909010-46909032 CTTTAGAGCCAAGAGTGGTGTGG + Intergenic
1167074477 19:47240218-47240240 TTCCAGAGCCACGATACCTGCGG - Intergenic
928951562 2:36817719-36817741 TTGCAGAGCCAAGTTGGGTGGGG - Intergenic
929940534 2:46330534-46330556 TGCCAGAGCCAAGACTTCTGAGG - Intronic
932059954 2:68486417-68486439 TTTCAGATCCAACATTGCAGAGG - Intronic
932150786 2:69369706-69369728 CTTCAGAGCCACCATTCCTGAGG - Intronic
932289065 2:70559886-70559908 GTACAGAGACAACATTGCTGGGG + Intergenic
933052773 2:77620532-77620554 CTTCAAAGCCTAGGTTGCTGAGG - Intergenic
933760491 2:85668766-85668788 AGTCAGAGACAAGATTTCTGTGG + Intergenic
934579806 2:95428862-95428884 TTTTAGAACCAAGGTTCCTGTGG + Intergenic
934599641 2:95647863-95647885 TTTTAGAACCAAGGTTCCTGTGG - Intergenic
940387200 2:153087154-153087176 TTTCTATGCCAATATTGCTGAGG + Intergenic
940490911 2:154359359-154359381 TTTCAGAGCCAAGAGTGAGCAGG + Intronic
943828971 2:192434262-192434284 TTTCAGAGTCAAGTCTTCTGGGG + Intergenic
944396198 2:199269870-199269892 TTTCACTGCCAAGTTTGCAGTGG - Exonic
944436929 2:199699867-199699889 CTTCAGTGCCTAGTTTGCTGAGG - Intergenic
945995341 2:216431721-216431743 TTTCAGAGCCAGATTGGCTGGGG - Intronic
947181294 2:227413682-227413704 GTGCAGAGCCAACACTGCTGAGG + Intergenic
1169294116 20:4377880-4377902 TTTCAGTGCCAAGAGTGATGGGG + Intergenic
1169791255 20:9413121-9413143 TGTAAGAGCCAGGAGTGCTGAGG - Intronic
1170017366 20:11797018-11797040 ATTCAGTGCCAACTTTGCTGGGG + Intergenic
1170128978 20:12998406-12998428 TTTTAAGGCCAAAATTGCTGAGG - Intergenic
1170467979 20:16640044-16640066 TTTCAGGGCCAAGGAAGCTGGGG - Intergenic
1170609721 20:17902623-17902645 AGTCAGAACAAAGATTGCTGGGG - Intergenic
1170716072 20:18832197-18832219 ATTCAGACCCAGGAGTGCTGTGG + Intergenic
1173455237 20:43196377-43196399 AGTCAGAGCTAAGGTTGCTGCGG - Intergenic
1174241151 20:49136094-49136116 TTTTAGAGACAAGGTTGCTCAGG - Intronic
1174391380 20:50220300-50220322 TTACAGAGCCAGGAATGCAGAGG + Intergenic
1176248798 20:64110187-64110209 TTTCTGAGCCCTGAGTGCTGGGG - Intergenic
1177964645 21:27712953-27712975 TTTCAGAGCCAAACTTACTTTGG - Intergenic
1178821318 21:35977604-35977626 TTTCAGAGCACAGACTGCTATGG - Intronic
1179032839 21:37735452-37735474 ATTCAGAGCCTACAGTGCTGAGG - Intronic
1180972517 22:19822790-19822812 GTTCAGAGGCAGGAGTGCTGTGG + Intronic
1181003412 22:19998448-19998470 TTTCGGAGCCAAGGAAGCTGAGG + Intronic
1181088090 22:20453118-20453140 TTTCAGAGCAAAGGTTGTTTAGG - Intronic
1181397235 22:22631041-22631063 CTTCGGAGTCAAGATTGCTGTGG + Intergenic
1181499981 22:23310404-23310426 CTTCGGAGTCAAGATTGCTGTGG + Exonic
1181705204 22:24645716-24645738 CTTCGGAGTCAAGATTGCTGTGG + Intergenic
949809592 3:7991903-7991925 CTTCATAGCCAAGATTTCTAAGG - Intergenic
951066093 3:18267302-18267324 TTTCAGAGGCACGTGTGCTGGGG + Intronic
951429001 3:22584541-22584563 ATTCAGAACCAAGTTTACTGGGG - Intergenic
952204417 3:31165797-31165819 TTTCACAGATAAGGTTGCTGAGG + Intergenic
956427924 3:69155770-69155792 TTTCTGAGCTAGGAATGCTGGGG - Intergenic
956834428 3:73084276-73084298 TGTCAGAGCCAAGATGTCTTTGG + Intergenic
957457103 3:80466106-80466128 CTTCAGTGCCTAGTTTGCTGAGG + Intergenic
957939480 3:86987639-86987661 TTATAGAGCCAAAATTACTGAGG - Intronic
958726566 3:97912728-97912750 TTTCAGACCCATGATTCCTTTGG + Intronic
959487128 3:106939692-106939714 GTTCAGGGACAAGATTGGTGAGG + Intergenic
959993414 3:112654076-112654098 TTTCAGAGCCAAACCAGCTGTGG - Intergenic
961121463 3:124374804-124374826 TTTGAGAGAGAACATTGCTGTGG + Intronic
963398463 3:144764371-144764393 TTTCATAGGAAAGCTTGCTGTGG + Intergenic
964193134 3:154029581-154029603 TTTCAGACTGAAGATTGCAGAGG - Intergenic
964403285 3:156321594-156321616 TTTCAGAACAAAGATTTATGTGG + Intronic
965294170 3:166922469-166922491 TTTTAGAACAAAGATTTCTGAGG - Intergenic
967508796 3:190286267-190286289 TTTCAGTTCCAGGATTTCTGGGG + Intergenic
968437582 4:602162-602184 TTTCACAACCAAGGTGGCTGGGG - Intergenic
970563707 4:17309876-17309898 TTTAAGAGACAAGATTTGTGGGG - Intergenic
971136621 4:23875692-23875714 TCTCAGAGCAAATTTTGCTGTGG - Intronic
971515344 4:27479222-27479244 TGTCAGTGCCTTGATTGCTGAGG + Intergenic
975746757 4:77482451-77482473 TTGCAGAGCCCAGATTTGTGGGG - Intergenic
976796722 4:88941973-88941995 TCTTAGAGCCAAGATGGCTTTGG - Intronic
977222181 4:94351032-94351054 TTTCATAGTCATGATTGCTGTGG + Intergenic
978862334 4:113465331-113465353 TTTCAGAGAAAAGATTTCAGAGG - Intronic
981807167 4:148730361-148730383 TTTCAGAGGCAAAATTGGTGTGG - Intergenic
983556205 4:169061355-169061377 TTTCAGAGGGAAGATGGGTGGGG - Intergenic
984674835 4:182535009-182535031 ATTAAGAGTCAGGATTGCTGTGG + Intronic
985031543 4:185795383-185795405 GTACAGATCAAAGATTGCTGAGG - Intronic
985175873 4:187200179-187200201 TTTCAGTAACAAGATTGCTGAGG + Intergenic
986587912 5:9337768-9337790 GTTCAGAGCGAAGAATGCTGTGG - Exonic
987569645 5:19639422-19639444 TTTAATAGCAAAGATTGCTTGGG - Intronic
990830985 5:59956568-59956590 TTTGTGAGCCAAGATGACTGGGG + Intronic
992695634 5:79283734-79283756 TGTCAAAACAAAGATTGCTGAGG - Intronic
992807348 5:80350883-80350905 TTTCAGCGCCATGTGTGCTGAGG - Intergenic
993240984 5:85384928-85384950 TCTCAGTTCCAAGATTTCTGAGG + Intergenic
994820952 5:104650579-104650601 TTTCTAAGCAAAGATTGCTGGGG - Intergenic
997207516 5:132058754-132058776 TACCGGAGCTAAGATTGCTGAGG + Intergenic
999947363 5:156611906-156611928 TTTCAACTCCAAGATTTCTGGGG + Intronic
1002371378 5:178757702-178757724 TCTCAGAGCCAGGAGTGCTGAGG - Intergenic
1003152677 6:3565952-3565974 GTGCAGAGTCCAGATTGCTGAGG + Intergenic
1003967590 6:11267968-11267990 TTTCAGAGCCAGCAAAGCTGAGG - Intronic
1005026042 6:21464115-21464137 TTTCAGAGACAAGAGTGCTTTGG - Intergenic
1007244122 6:40447818-40447840 TTTGAGAGCCCAGATGGATGAGG - Intronic
1007438504 6:41836339-41836361 TTTCAGTGCCTAGTTTGTTGAGG - Intronic
1007877393 6:45121146-45121168 TTTCTGGGCCAAGATTTTTGTGG - Intronic
1008041965 6:46811645-46811667 TTTCTGTGCCAATTTTGCTGAGG + Intronic
1012375477 6:98556900-98556922 TATCAAAGGCAATATTGCTGAGG - Intergenic
1012846647 6:104397688-104397710 TTTGATAGCTAAGAATGCTGAGG + Intergenic
1016110478 6:140218027-140218049 TTTCAGTTCCAGGATTTCTGGGG + Intergenic
1017135079 6:151140887-151140909 GTTCAGTGCCAAAATTGCTCTGG + Intergenic
1017319665 6:153075238-153075260 TATCAGAAGCAAAATTGCTGGGG - Intronic
1018427057 6:163692574-163692596 TTTCACTGCTATGATTGCTGGGG - Intergenic
1018570088 6:165200596-165200618 TTTCAGTGCCTAGTTTGTTGAGG - Intergenic
1018610229 6:165641525-165641547 TCTGAGAGCCAGCATTGCTGGGG - Intronic
1018645944 6:165948671-165948693 TTTCAGAGCCAAGATTGCTGTGG + Intronic
1018873906 6:167803671-167803693 TTTCTGAGCCAACAGGGCTGGGG - Intergenic
1021049676 7:15967196-15967218 TTTCAGAGTCTAGAGTGCTATGG - Intergenic
1022344998 7:29505979-29506001 CTTCAGAACCAAATTTGCTGAGG + Intronic
1022481731 7:30748227-30748249 TTTCAGATGCAAGAGTGCAGCGG - Intronic
1024237704 7:47410343-47410365 TTTCATAGGCAAGAAAGCTGAGG - Intronic
1031187026 7:118494752-118494774 TTTCAGATCCAAGATTGTGCAGG + Intergenic
1033765051 7:144479980-144480002 TTCAAGAGACAAGATTGATGAGG + Intronic
1034685047 7:152963153-152963175 TTTCAGAAGCAAGGTTGCTTAGG - Intergenic
1035640973 8:1184949-1184971 TTTCAGACCCAGGTTTGCTAGGG + Intergenic
1036510617 8:9396808-9396830 TTTGTGAGGCAAGATGGCTGGGG + Intergenic
1039732198 8:40292317-40292339 TTTCAGGTCTAAGAATGCTGAGG + Intergenic
1043752871 8:83962336-83962358 TTGAAGAGCCAAAATTACTGTGG + Intergenic
1044678361 8:94752288-94752310 TTTAAAAGCTTAGATTGCTGGGG + Intronic
1044831574 8:96255148-96255170 TATCAGAGCCAATACTGCTGAGG + Intronic
1046761013 8:118020797-118020819 TTTTATAGCCAAGGTTGCTATGG - Intronic
1047096527 8:121632180-121632202 TTTTAGAGCCAGCTTTGCTGAGG + Intronic
1049078968 8:140425948-140425970 TTTCAGAGCCAAGATGCACGAGG + Intronic
1050087368 9:1980002-1980024 TTTCAGAGCCCAGCTTAATGAGG - Intergenic
1051031522 9:12685987-12686009 TTTAAGAGCTAAGAATGCTTAGG + Intronic
1053183484 9:35994134-35994156 TTTCAGAGGCAAGGCAGCTGTGG + Intergenic
1054747235 9:68866922-68866944 TTTGTGAGGCAATATTGCTGGGG + Intronic
1186151050 X:6675189-6675211 TTACAGAGGCAAAATTCCTGTGG - Intergenic
1186609516 X:11125341-11125363 TTTCATAGCCGAGAAAGCTGAGG - Intergenic
1191072396 X:56415158-56415180 ATTCAGTGCCAAGTTTGTTGAGG + Intergenic
1193282217 X:79666651-79666673 TTTCAGTGCCTAGTCTGCTGAGG - Intergenic
1193518423 X:82499413-82499435 TTTCAAAGCCTAGCTTGTTGAGG + Intergenic
1193696906 X:84719216-84719238 TTTCAGAGGGAAGATTTCTTAGG - Intergenic
1195257806 X:103106055-103106077 TCCCAGAGCCAAGATGGCTTTGG + Intergenic
1196566637 X:117213743-117213765 CTTCAGTGCCTAGTTTGCTGAGG - Intergenic
1198276583 X:135099668-135099690 TTTCACAGCAAAGATTGACGTGG + Intergenic
1199424596 X:147686185-147686207 CTTCTGTGCCAAGTTTGCTGGGG - Intergenic
1199547480 X:149021107-149021129 TTTCTAAGGCATGATTGCTGTGG - Intergenic
1199900359 X:152166641-152166663 ATTCAGAGCCAAAGTGGCTGGGG + Exonic