ID: 1018645945

View in Genome Browser
Species Human (GRCh38)
Location 6:165948672-165948694
Sequence TTCAGAGCCAAGATTGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 1, 2: 2, 3: 12, 4: 180}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018645941_1018645945 13 Left 1018645941 6:165948636-165948658 CCATCAAGAAACCATCGAGGTGA 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1018645945 6:165948672-165948694 TTCAGAGCCAAGATTGCTGTGGG 0: 1
1: 1
2: 2
3: 12
4: 180
1018645940_1018645945 14 Left 1018645940 6:165948635-165948657 CCCATCAAGAAACCATCGAGGTG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1018645945 6:165948672-165948694 TTCAGAGCCAAGATTGCTGTGGG 0: 1
1: 1
2: 2
3: 12
4: 180
1018645943_1018645945 2 Left 1018645943 6:165948647-165948669 CCATCGAGGTGAGAAACAAGGTG 0: 1
1: 0
2: 0
3: 15
4: 135
Right 1018645945 6:165948672-165948694 TTCAGAGCCAAGATTGCTGTGGG 0: 1
1: 1
2: 2
3: 12
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018645945 Original CRISPR TTCAGAGCCAAGATTGCTGT GGG Intronic
903045344 1:20560542-20560564 TTGTGTGCCAACATTGCTGTTGG - Intergenic
903091864 1:20927438-20927460 TTCAGAGAAAATATTGCTGCTGG - Intronic
903218922 1:21858095-21858117 TTCAGAGCCAAGACTCTTGCAGG + Intronic
904874264 1:33642052-33642074 TTCAAAGCCAAGAGTGATCTGGG + Intronic
905607117 1:39311758-39311780 TTCCAAGCAAAGATTGCTGTAGG + Intronic
907837637 1:58126219-58126241 ACCAGAGCCAAGATTCCTGTTGG + Intronic
909564278 1:77037738-77037760 TTAAGAGCTAAGAGTGCTGCAGG + Intronic
909799533 1:79788701-79788723 TTCAGAACTAAGATTTCTGAGGG + Intergenic
911110629 1:94180674-94180696 TTCAGATCCCAGAGTGGTGTAGG - Intronic
913044728 1:115064184-115064206 CTGAGAGTCAAGATGGCTGTAGG + Intronic
914705440 1:150166299-150166321 TTCAGAGCCAAGAATGTGCTGGG + Intergenic
914760188 1:150592480-150592502 TTCAGAGCCAAGATTGCAGTAGG + Intergenic
916151821 1:161800447-161800469 TTCAGAGCCAGGAATGATGGTGG - Intronic
916461978 1:165034716-165034738 GTGAGAGCAAAGGTTGCTGTTGG - Intergenic
916817744 1:168370114-168370136 TTCAGAGCCCAGATTCCTGTTGG + Intergenic
918104846 1:181407983-181408005 TACAGAGCCAAGATAGCTCAGGG + Intergenic
919120406 1:193333412-193333434 TTCAGCACCAGGATTTCTGTTGG + Intergenic
921435214 1:215111578-215111600 TTCAGCTCCAAAATTTCTGTTGG + Intronic
923551935 1:234970976-234970998 TGCTGAGCCAGGATTTCTGTTGG + Intergenic
924028894 1:239867057-239867079 TTCAGAGCCAAGCTTGGGGAAGG + Intronic
924297391 1:242601908-242601930 TTCAGAGCCCACAATGCTGCAGG + Intergenic
1062909638 10:1204497-1204519 TTCAGAGGCACGAGAGCTGTGGG - Intronic
1063195896 10:3742426-3742448 TGCAGAGCCAGGAATGCTGGTGG - Intergenic
1063490457 10:6459034-6459056 TTCAGGGGCAAGGCTGCTGTTGG - Intronic
1064280508 10:13947009-13947031 TTCAGAGAGGAGATTGTTGTGGG + Intronic
1065331076 10:24600319-24600341 TTCAAAGACAGGATTGTTGTAGG - Intronic
1068498178 10:57811960-57811982 TTAAGAGACAAGATTGCCCTAGG + Intergenic
1068853291 10:61769428-61769450 TCCAGAGCCAACGTTGTTGTGGG + Intergenic
1070040489 10:72773307-72773329 TTCATTTCCAAGATTTCTGTGGG - Intronic
1071356848 10:84805599-84805621 TGCAGAGCCAAGATTTGAGTTGG + Intergenic
1073495923 10:103890815-103890837 TTCACAGGCAAGATTCCTGACGG - Intronic
1074540119 10:114358013-114358035 TTCAGAGCTAGGATTGTTCTGGG - Intronic
1075439836 10:122471189-122471211 TTCAGAGCCACAAATGCTGGTGG - Intronic
1076927218 10:133497873-133497895 TTCAAAGTCACAATTGCTGTGGG - Intergenic
1077241133 11:1510639-1510661 GTCAGAGCCAGGCTTGCTGGGGG + Intergenic
1079134493 11:17768695-17768717 TTGAGAGCCAAGTGTGCAGTGGG + Intronic
1081236558 11:40654093-40654115 TCCAGAGACAAGTTTGCTGAGGG + Intronic
1082988806 11:59189809-59189831 TTCAGAGCAGAGATTTCTGTAGG - Intronic
1083443770 11:62693648-62693670 TTCAGAAACAAGCTAGCTGTGGG - Intronic
1084546961 11:69819397-69819419 TTCAGAGCCAGGAGGGCTTTCGG - Intergenic
1084904542 11:72335518-72335540 TTCAGAACCAAGATGGAAGTGGG - Intronic
1085148450 11:74226052-74226074 TTCAGAGCCCAAACTGATGTAGG + Intronic
1089328140 11:117671435-117671457 CTCAGATCCCAGACTGCTGTTGG - Intronic
1094818803 12:34209422-34209444 GCCAGGGCCAAGATTCCTGTCGG + Intergenic
1095397489 12:41777337-41777359 TTCTGCACCAAGAATGCTGTTGG + Intergenic
1096042809 12:48533718-48533740 TTCAAAGCCTAGTTTGCTGAGGG - Intergenic
1096277689 12:50224483-50224505 TACAGAGCCAAGAGTGCTGCTGG - Intronic
1097983009 12:65753446-65753468 TTCAGAGCCAACAGTTCTGCTGG - Intergenic
1098470187 12:70833922-70833944 GTCAGAGCCAAGATCATTGTAGG - Intronic
1100155215 12:91791391-91791413 TGCAGAGCCAACATGGCTGCTGG + Intergenic
1101541383 12:105668773-105668795 TTCTGAGCCAGGATGGTTGTAGG + Intergenic
1104278645 12:127353602-127353624 TTCAAAGCCAGGACTGCTGGTGG + Intergenic
1105717509 13:23081984-23082006 TTTTGAGCCAGCATTGCTGTTGG - Intergenic
1108638467 13:52359697-52359719 AGCAGAGCCAAGTTTTCTGTAGG - Intergenic
1109073866 13:57807193-57807215 TTCAGTTCCAAGATTTCTATTGG - Intergenic
1109278383 13:60327372-60327394 TTCAAAGCCAAGTTTTCTTTTGG + Intergenic
1112361176 13:98719917-98719939 TTCAAAGCTAAAATGGCTGTTGG - Intronic
1113384014 13:109831056-109831078 TCCTGAGCCAAGATTGTTGGTGG + Intergenic
1113526590 13:110983578-110983600 TACAGAGCAAAGATTGTGGTAGG + Intergenic
1114896455 14:26996476-26996498 ATCCCATCCAAGATTGCTGTGGG - Intergenic
1116160665 14:41263811-41263833 TTCAGAGCCAACATTGTTCCTGG + Intergenic
1116927714 14:50657383-50657405 TTCATAGCCAAAACTGCTCTAGG + Intronic
1120484873 14:85100560-85100582 TTAAGATCCAAGATAGCTGCTGG + Intergenic
1121357764 14:93230212-93230234 TTCAGAGGCCAGATTGCAGAGGG + Intergenic
1122500947 14:102199150-102199172 TTCACAGCCCAGAATGCTGAGGG + Intronic
1122704009 14:103608771-103608793 GGCAGAGCCAAGAAAGCTGTAGG + Intronic
1126891315 15:53207368-53207390 TTCAGGGCCAACATTGCCCTGGG + Intergenic
1129788058 15:78322308-78322330 TGCACATCCAGGATTGCTGTTGG - Intergenic
1130219091 15:82002666-82002688 TTCTTATTCAAGATTGCTGTGGG - Intergenic
1131303012 15:91216336-91216358 TTCCCAGCTAAGATTGCTGGGGG - Intronic
1131618216 15:94038877-94038899 TTCAGTGCCTAGTTTGCTGAGGG - Intergenic
1131745739 15:95445322-95445344 TTCAGAATCAAGGTTGGTGTGGG - Intergenic
1136297755 16:29313349-29313371 TCCAGAGCCCAGATTGCCGGAGG - Intergenic
1138343593 16:56306782-56306804 TTCTGAGCAAAGATTCCAGTTGG + Intronic
1140561129 16:75982967-75982989 GACAGAGACAAGAATGCTGTTGG - Intergenic
1142059311 16:88019427-88019449 TCCAGAGCCCAGATTGCCGGAGG - Intronic
1142546329 17:706134-706156 TTTAGTGCCTAGAGTGCTGTCGG + Intronic
1144072036 17:11683035-11683057 TTCAGAGCCAAAACTGCTGAAGG + Intronic
1144251865 17:13425396-13425418 TTCACTGCCAACATTCCTGTTGG + Intergenic
1146375070 17:32288290-32288312 TTCAGAGTGATGGTTGCTGTGGG - Intronic
1147285072 17:39395987-39396009 TTCAAAGCCAAGAGTTTTGTGGG + Intronic
1147343021 17:39766366-39766388 TTCGGCGCCAAGATAGCTGATGG + Exonic
1156680352 18:39580899-39580921 TTGTGAATCAAGATTGCTGTTGG - Intergenic
1157782749 18:50454555-50454577 CTCAGAGCCAAGACTGCTCTGGG - Intergenic
1158221790 18:55158577-55158599 CTCAGAGCCTCAATTGCTGTGGG + Intergenic
1159047468 18:63382949-63382971 TTCAGAGGCTAGATTGCTAAAGG + Intergenic
1159462643 18:68740332-68740354 TTCAAAACTAAGATTGATGTTGG - Intronic
1161043085 19:2120475-2120497 TTCTGAGCCCTGTTTGCTGTAGG - Intronic
1161595986 19:5151219-5151241 CACAGAGCCCTGATTGCTGTGGG - Intronic
1164137706 19:22428543-22428565 TTCAGAGCCATCTTTGCCGTAGG - Intronic
1164187981 19:22888798-22888820 TTCAGAACCAACCTTGCTATTGG + Intergenic
1164687823 19:30180226-30180248 TTCAGAACCAGGATAGCTGATGG + Intergenic
927034363 2:19158334-19158356 TTCACAGCTAAGCTTGCAGTTGG + Intergenic
927834431 2:26381787-26381809 TTTAGAGATAAGATTTCTGTTGG + Intronic
928732160 2:34243895-34243917 TTTATTGCAAAGATTGCTGTTGG - Intergenic
930122277 2:47769853-47769875 TGCAGAGCCCAGAATCCTGTGGG + Intronic
930853869 2:55991317-55991339 TCCACAGCCAAGATAGCTGCAGG - Intergenic
931564163 2:63596501-63596523 TAAAGGGCCCAGATTGCTGTTGG + Intronic
932289066 2:70559887-70559909 TACAGAGACAACATTGCTGGGGG + Intergenic
933052772 2:77620531-77620553 TTCAAAGCCTAGGTTGCTGAGGG - Intergenic
942259915 2:174149047-174149069 TTCAGAGCCAAGCTTCTTGAAGG + Intronic
946703399 2:222434726-222434748 ATCAAAGCAAAGATTCCTGTGGG + Intronic
946888998 2:224254803-224254825 TTCACAGCAAAGCTTCCTGTAGG + Intergenic
947181295 2:227413683-227413705 TGCAGAGCCAACACTGCTGAGGG + Intergenic
1170017367 20:11797019-11797041 TTCAGTGCCAACTTTGCTGGGGG + Intergenic
1170716073 20:18832198-18832220 TTCAGACCCAGGAGTGCTGTGGG + Intergenic
1173120479 20:40284728-40284750 TTCAGAGCCAAGCCACCTGTAGG + Intergenic
1173455236 20:43196376-43196398 GTCAGAGCTAAGGTTGCTGCGGG - Intergenic
1174431833 20:50475701-50475723 TTCAGGGCCAGGAGGGCTGTGGG + Intergenic
1174877820 20:54246644-54246666 CTCAGAACCAAGAGTGCTGAAGG + Intergenic
1175498375 20:59431407-59431429 TTCAGAGCCAACCTTGTGGTAGG + Intergenic
1177442364 21:21142864-21142886 TTCAGAGCTATGATTTTTGTAGG + Intronic
1177964644 21:27712952-27712974 TTCAGAGCCAAACTTACTTTGGG - Intergenic
1179728071 21:43351531-43351553 TTCAGAGCCAAGATAGGGCTTGG + Intergenic
1181553500 22:23654254-23654276 TTCAGAGCCAAGGGAGCAGTAGG - Intergenic
1184714855 22:46275297-46275319 TTCAGGGCCAACATGTCTGTCGG - Exonic
952683632 3:36124107-36124129 TTCAGCTCCAGGATTTCTGTTGG - Intergenic
953026298 3:39147149-39147171 GTCAGCGCCAGGATTCCTGTCGG - Intronic
956834429 3:73084277-73084299 GTCAGAGCCAAGATGTCTTTGGG + Intergenic
957457104 3:80466107-80466129 TTCAGTGCCTAGTTTGCTGAGGG + Intergenic
957651749 3:83015530-83015552 TTCAAAGCCAAAATTGCCATAGG - Intergenic
958788890 3:98628958-98628980 TTCATAGCCAAGGTAGGTGTAGG + Intergenic
959993413 3:112654075-112654097 TTCAGAGCCAAACCAGCTGTGGG - Intergenic
961121464 3:124374805-124374827 TTGAGAGAGAACATTGCTGTGGG + Intronic
962923660 3:139972901-139972923 TTCTGAGCCAAAAATGCTGGAGG - Intronic
964403286 3:156321595-156321617 TTCAGAACAAAGATTTATGTGGG + Intronic
965695906 3:171407911-171407933 CTCAGAACCATGATTGCTGAAGG - Intronic
965891921 3:173524738-173524760 TTCAGTGCCTAGTTTGTTGTGGG + Intronic
967311222 3:188108101-188108123 TCCAAAGCCAAGCTTGCTCTAGG + Intergenic
967734646 3:192939419-192939441 TTAAGAGTCAAGAGTGCTGTAGG - Intergenic
967818927 3:193823238-193823260 TTCAAAGCCAAGAGTTTTGTGGG - Intergenic
973156419 4:46959894-46959916 CTCAATGCCAGGATTGCTGTAGG - Intronic
973810775 4:54568043-54568065 TTCATGGCCATGAATGCTGTGGG + Intergenic
973956634 4:56069319-56069341 TTCATGGAAAAGATTGCTGTTGG + Intergenic
977222182 4:94351033-94351055 TTCATAGTCATGATTGCTGTGGG + Intergenic
977754711 4:100654066-100654088 AGCAGAGCTAAGGTTGCTGTGGG - Intronic
977890496 4:102305375-102305397 TTCAAGGCAAATATTGCTGTAGG - Intronic
978258103 4:106717386-106717408 TTCAGTGCCAGAATTGATGTTGG - Intergenic
980210361 4:129779576-129779598 TTCAGATTCATGATTGGTGTTGG - Intergenic
987201708 5:15583896-15583918 TCCAGAGAGAAGTTTGCTGTAGG - Intronic
989167500 5:38445967-38445989 TTCAGGGGAAAGATGGCTGTTGG + Intronic
989238831 5:39180253-39180275 TTCAGACTCTAGAATGCTGTTGG + Intronic
989390288 5:40893563-40893585 CTCAGTTCCAAGATTTCTGTTGG + Intergenic
993158522 5:84258431-84258453 TCCAGAGCAAAGATTATTGTTGG + Intronic
993840652 5:92875049-92875071 TTCAGCTCCAAGATTTTTGTTGG + Intergenic
994820951 5:104650578-104650600 TTCTAAGCAAAGATTGCTGGGGG - Intergenic
996008552 5:118453807-118453829 TTGAGAGCCAGTTTTGCTGTTGG - Intergenic
997156851 5:131570869-131570891 TTTAGAGCTAAGATTACAGTTGG + Intronic
997419584 5:133755429-133755451 TTCTGAGCCAAGAGAGCTGGTGG - Intergenic
997438032 5:133889218-133889240 CTCAGAGCCAACAATGCTGTTGG - Intergenic
997626190 5:135332201-135332223 TTCAGAGGCAGGCTTGCAGTGGG - Intronic
1000793639 5:165637563-165637585 TTCAGATCAAAGATGGGTGTAGG - Intergenic
1000834491 5:166136738-166136760 TTCAGTTCCAAGATTTGTGTTGG - Intergenic
1002371377 5:178757701-178757723 CTCAGAGCCAGGAGTGCTGAGGG - Intergenic
1002376717 5:178794467-178794489 TCCAGGGCCAAGATTCCTGCTGG - Intergenic
1002529251 5:179834166-179834188 GTCATAGCCAAGATCCCTGTAGG + Intronic
1004021379 6:11778933-11778955 TTCAGAGGCAGGATTACTGCTGG + Intronic
1007062679 6:38956057-38956079 TTCACTGCCAAGATCGATGTTGG - Intronic
1007594968 6:43045719-43045741 TGCAGAGCCAAGTTGGCTCTAGG + Intronic
1007935442 6:45728256-45728278 GTCAGAGCCAAGACAGCTGCAGG - Intergenic
1009477531 6:64112300-64112322 TTCACAGCCAAGAAAGCTGTTGG + Intronic
1010792593 6:80081635-80081657 TTCACTTCCAAGATGGCTGTTGG - Intergenic
1011466170 6:87659395-87659417 TTCAGTGCCTAGCCTGCTGTTGG - Intronic
1015218937 6:130782141-130782163 CTCAGGGCCAAGATGGCTGCTGG + Intergenic
1015342616 6:132119041-132119063 TTCAGGGACAAGATGTCTGTGGG + Intergenic
1015856051 6:137625561-137625583 TTCAGAACCAAGTTTCGTGTGGG - Intergenic
1018522887 6:164671412-164671434 TTTGGAGCCAATATTGCTCTGGG + Intergenic
1018645945 6:165948672-165948694 TTCAGAGCCAAGATTGCTGTGGG + Intronic
1018869124 6:167768169-167768191 TGCAGGTCCAAGATAGCTGTAGG + Intergenic
1019686536 7:2384948-2384970 TTCAGAGCCAGGCCTGCTGAAGG - Intergenic
1021049675 7:15967195-15967217 TTCAGAGTCTAGAGTGCTATGGG - Intergenic
1022816030 7:33915047-33915069 TCCAAAACTAAGATTGCTGTAGG + Intronic
1026305371 7:69135627-69135649 TTCAGAGCTATATTTGCTGTGGG - Intergenic
1027443755 7:78247612-78247634 TTCAGCTCCAAGATTTCTATTGG - Intronic
1027510712 7:79076213-79076235 TTCAGAGCCAATATATCTCTAGG - Intronic
1027889096 7:83947825-83947847 TTCAAAGCTAAAATTGCTGTTGG - Intergenic
1030808004 7:113939538-113939560 TTGAGAGACAATATAGCTGTGGG + Intronic
1030905741 7:115180049-115180071 AGCAGAAGCAAGATTGCTGTTGG - Intergenic
1032871730 7:135993185-135993207 TTCAGTGCCAACATTGTTTTAGG + Intergenic
1033861020 7:145627963-145627985 AACAGAGCCCAGATTGTTGTGGG + Intergenic
1034568399 7:151934046-151934068 TTCAGAACCATGATTACTTTAGG - Intergenic
1039212464 8:35233561-35233583 TTCAAAGCAAAGACTGATGTGGG - Intergenic
1043612268 8:82079532-82079554 GTCAGAGGTAAGATTGCTGCAGG + Intergenic
1043752872 8:83962337-83962359 TGAAGAGCCAAAATTACTGTGGG + Intergenic
1043819583 8:84845928-84845950 TTCAGAGATTAGATGGCTGTAGG + Intronic
1046556171 8:115776108-115776130 TTCACAGCCAGCACTGCTGTTGG - Intronic
1048454403 8:134564986-134565008 TTCAGATCCTGGATTGCTGCAGG - Intronic
1051533807 9:18134295-18134317 TGCAGAGGCAAGTTTGTTGTTGG + Intergenic
1051831606 9:21285237-21285259 TTCACAGCCATGAATGCTGCAGG + Intergenic
1186235806 X:7508134-7508156 TTCAGAGCCAGGGTTTCTATTGG + Intergenic
1190330590 X:49233017-49233039 GTCAGAGCCAGGATTGAGGTTGG + Intronic
1193914824 X:87352074-87352096 TACAGAGCCAATATTGCTTGAGG - Intergenic
1196566636 X:117213742-117213764 TTCAGTGCCTAGTTTGCTGAGGG - Intergenic
1197998723 X:132409511-132409533 TTCAGAGCCAAGATGGCTGCTGG - Intronic
1198276584 X:135099669-135099691 TTCACAGCAAAGATTGACGTGGG + Intergenic
1201601887 Y:15738610-15738632 TTCAGAGCCAGGGTTTCTATTGG + Intergenic