ID: 1018647426

View in Genome Browser
Species Human (GRCh38)
Location 6:165961367-165961389
Sequence GCTTCCTTCTGAAGTAGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018647426_1018647430 0 Left 1018647426 6:165961367-165961389 CCTGTCCTACTTCAGAAGGAAGC 0: 1
1: 0
2: 0
3: 17
4: 144
Right 1018647430 6:165961390-165961412 CAGGATGAAATGCGATCATGTGG No data
1018647426_1018647431 23 Left 1018647426 6:165961367-165961389 CCTGTCCTACTTCAGAAGGAAGC 0: 1
1: 0
2: 0
3: 17
4: 144
Right 1018647431 6:165961413-165961435 AAATGCTAAGCCCGCCTTAGCGG No data
1018647426_1018647432 24 Left 1018647426 6:165961367-165961389 CCTGTCCTACTTCAGAAGGAAGC 0: 1
1: 0
2: 0
3: 17
4: 144
Right 1018647432 6:165961414-165961436 AATGCTAAGCCCGCCTTAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018647426 Original CRISPR GCTTCCTTCTGAAGTAGGAC AGG (reversed) Intronic
903347698 1:22697858-22697880 GCTTCCTTCTGAGGTCAGACAGG + Intergenic
906148265 1:43572744-43572766 GCAGCCCTGTGAAGTAGGACAGG + Intronic
907504802 1:54910327-54910349 GCTTCCATCTTAAAAAGGACTGG - Intergenic
911789557 1:101996429-101996451 GCTCTCTTTTGAAGTCGGACGGG - Intronic
912072608 1:105830973-105830995 GCTTACTTGTGAAGCAGGAAGGG - Intergenic
912894669 1:113574356-113574378 GCTTCCTTCAGGAGTAAGGCAGG + Intronic
917212299 1:172643507-172643529 GCTTCCTTTTGCAGAAGGCCTGG - Intergenic
921636000 1:217494298-217494320 GCTTCCTTTTGAAGTTGCAGTGG - Intronic
1063960202 10:11300394-11300416 GCTTCCTTGGGAAGCAGAACTGG + Intronic
1067185958 10:44028593-44028615 ACGTCCTTCTGCAGCAGGACAGG + Intergenic
1068734179 10:60393231-60393253 GCTGCCTTCTGGAGGAGGGCTGG - Intronic
1068735463 10:60409007-60409029 GCTGCCTGCTTAAGGAGGACAGG - Intronic
1070157164 10:73842376-73842398 GCTTCCTTCTGAAATGGGGCAGG + Intronic
1071280132 10:84094310-84094332 GCCACCTTGTGAAGAAGGACAGG - Intergenic
1071570785 10:86695717-86695739 GCTTCCTTCTGACTTTGGAAAGG + Intronic
1074154127 10:110783349-110783371 CTTTCCTTCTGACCTAGGACTGG + Exonic
1079027734 11:16962027-16962049 CCTCCCTTCTGAAGTGGGAGTGG - Intronic
1079946635 11:26751102-26751124 GCTACTTTCTGAAGTATGAAGGG + Intergenic
1081891003 11:46542481-46542503 GCTTCTTTCTGGAGTATGACCGG - Exonic
1082798049 11:57392711-57392733 ACTTCCTTCTGAATTAGCAGAGG - Intronic
1085576557 11:77610082-77610104 GCTACCTTATGAAGTAGGGAGGG + Exonic
1088884207 11:113994432-113994454 CTTTCCATCTGAAGTGGGACGGG - Intergenic
1089504656 11:118955523-118955545 GCTTCTTTCTGATGTAGCCCAGG + Intronic
1091821431 12:3478419-3478441 GCTTCCTTCAGAAGGTGGAGGGG - Intronic
1091881146 12:3979240-3979262 GCTTCATCCTGAAGTACGTCTGG + Intergenic
1093336790 12:17914419-17914441 GCTTCCATCTGAAGAATGAGAGG - Intergenic
1095965273 12:47863328-47863350 TCTTCCTCCTGAGGTAGGAGAGG + Intronic
1095985845 12:47999109-47999131 GCTTCCTGCTGAAGTAGAGAAGG - Intronic
1096685091 12:53283020-53283042 GCTTCCTTCTGCATTAAGGCAGG - Intronic
1097830160 12:64215937-64215959 CCTTCCTGCTGAAGAAAGACTGG + Exonic
1098007475 12:66013499-66013521 GCTTTCTGCTGAAATAGGATGGG + Intergenic
1099348819 12:81538816-81538838 GCTTCCATCTGGAGTAAGACAGG + Intronic
1099992366 12:89737597-89737619 CCTTCCTTCCCAAGAAGGACAGG + Intergenic
1100294046 12:93244264-93244286 GCTTCCTCCTGAAGTGGGAGGGG - Intergenic
1100984392 12:100190431-100190453 GCTTCCTTCTCTAGAAGGTCTGG + Intergenic
1101705231 12:107215092-107215114 GTTTCCTTCCGAAATAGGAGAGG - Intergenic
1106068409 13:26381300-26381322 GCTTCTCTCTGAAGTAGGCCGGG + Intronic
1109789558 13:67229543-67229565 GCTACCTACTTGAGTAGGACTGG + Intronic
1113506986 13:110823819-110823841 GTTTCATTCTGAAGAAGGATTGG + Intergenic
1114566730 14:23638823-23638845 GCTTCCTGCTGAATCAGGCCTGG - Exonic
1115861220 14:37688038-37688060 GCTTCCCTCTGACCTAGGGCAGG - Intronic
1117344943 14:54822578-54822600 CCTTTCTTCTGAAGAAAGACAGG + Intergenic
1117849982 14:59958000-59958022 GCTTCATCCTGAAGGAGCACTGG + Intronic
1128526399 15:68415141-68415163 GCTTCCTTCAGAAGAAAGGCAGG - Intronic
1128685009 15:69677528-69677550 GCCTCCTGCAGAAGGAGGACAGG - Intergenic
1129266306 15:74395341-74395363 GCCTCCTTCAGCAGTAGGGCTGG + Intergenic
1134188030 16:12099611-12099633 GCTTCCTTCTGGAGGCCGACAGG - Intronic
1137516040 16:49145257-49145279 GTTTCCTTCTGGAGTAGGAAAGG + Intergenic
1140663304 16:77208195-77208217 GCTTCCCTCTGAAGAAAGAAAGG - Exonic
1140875884 16:79152307-79152329 GCTTCCTCCTGAATCAGGAGTGG + Intronic
1141234433 16:82202302-82202324 GCTTCACTGTGAAGTAAGACAGG - Intergenic
1144520935 17:15951830-15951852 GGTTCCCTCTGAAGGAGGCCGGG + Intronic
1144687211 17:17234114-17234136 GTTTCCTTCTCAAGCAGGAGAGG + Intronic
1145051631 17:19666429-19666451 GCTATCTTGTCAAGTAGGACAGG - Intronic
1145804681 17:27718008-27718030 GTTTCCTTCTGAAATAGGAGAGG - Intergenic
1148158080 17:45434814-45434836 TCTTCTCTCTGAAGGAGGACAGG - Intergenic
1148484314 17:47980978-47981000 GCTTGCTTCCTGAGTAGGACAGG + Intronic
1149433051 17:56609770-56609792 GGTTCCTTCTTATGTAAGACAGG + Intergenic
1157245899 18:46055067-46055089 GCTTCCTACTAAAGTCGCACTGG + Intronic
1157302103 18:46486495-46486517 GCATCCTTCTGCAGTAGGGAGGG + Intronic
1157389495 18:47289246-47289268 ACTTCCTTCAGAAGTGGTACAGG + Intergenic
1157644164 18:49250377-49250399 GCTTCTTTCAGAAGTAGGTGTGG - Intronic
1161571422 19:5032785-5032807 GCTCCGTTCTGAGGGAGGACGGG + Intronic
1166250956 19:41570546-41570568 GGGTCCTGCTGAAGTGGGACCGG + Intronic
927651966 2:24918768-24918790 GCTGCCTTTTGAAGTAGGTCTGG + Exonic
928780852 2:34818761-34818783 GCTTGCTTTTGAAGTCAGACAGG + Intergenic
930828748 2:55720301-55720323 GCTTTCTTCTGGAGAAGGACTGG - Intergenic
931793973 2:65691892-65691914 GCTTCCAGCAGAAGTGGGACTGG + Intergenic
934026497 2:88005756-88005778 GCTTCCTTCTGAGGGAGGGATGG - Intergenic
934556654 2:95290079-95290101 GCTTCCTTCTGAAGAGGTAAGGG - Exonic
934769124 2:96896675-96896697 GCTTCCTCCTCACCTAGGACAGG + Intronic
935309742 2:101771836-101771858 GCTTCCATTTAAAGAAGGACAGG - Intronic
936086436 2:109472687-109472709 GCCTCCTTCTGAAGGATGTCTGG - Intronic
937105877 2:119312212-119312234 GCTTCTCTCAGAAGTCGGACTGG - Intronic
938564388 2:132505168-132505190 GCTGAGTTCTGCAGTAGGACAGG + Intronic
940341431 2:152585940-152585962 GCTTCCTTCTGAAGTCAAAGAGG + Intronic
940640462 2:156340950-156340972 GCTTCCTCCAGAGGTAGGAGGGG + Intronic
945046135 2:205783588-205783610 GCTTCCTTCTGAGGAAGTTCAGG + Intronic
945961627 2:216141464-216141486 TTTACCTTCTGAAGTAGGAGAGG - Intronic
947906467 2:233766838-233766860 ACTTCCTTCTAAAGGAGGAAGGG - Intronic
948121884 2:235536893-235536915 CCTTCCCTCTGTAGTTGGACAGG + Intronic
1168959496 20:1859131-1859153 GCTTCCTTTTTAACTAGGAGTGG + Intergenic
1169480816 20:5978857-5978879 TATTCATTCTGAAGTAGGCCAGG - Intronic
1170897739 20:20431217-20431239 GGCTCCTTAAGAAGTAGGACTGG + Intronic
1170920148 20:20670452-20670474 CTTTCCTTCTGAAGTAGGTTTGG - Intronic
1172320493 20:33992619-33992641 TCTTCCTTTTGAAGCAGGGCAGG + Intergenic
1172502546 20:35437479-35437501 CCTTCCTGCTGAAGAAGGCCAGG - Exonic
1173980760 20:47222142-47222164 TCTTCCTTCTAAGGTGGGACAGG + Intronic
1175157755 20:56983694-56983716 GCTACCTTCAGAGGGAGGACAGG - Intergenic
1176881289 21:14197529-14197551 GATTCTTTCTGAAATAAGACAGG + Intronic
1178893373 21:36538968-36538990 GCTTGCTTCTCAACTAGGCCCGG + Intronic
1179254916 21:39707210-39707232 GCTTCCTGCTGACAGAGGACTGG + Intergenic
1180164817 21:46019601-46019623 GATTCCTTATGAATTAGGGCTGG - Intergenic
1180890884 22:19287854-19287876 GCTGCCTACTGAAGAAGGCCAGG - Intronic
1182156209 22:28075522-28075544 GGCTCCTTCTCAAGTAGGATGGG - Intronic
1182382538 22:29904250-29904272 GCTACCTTGTGAAGTAGGCACGG + Intronic
957904387 3:86538609-86538631 GCTTCCTACTTAAAAAGGACTGG - Intergenic
963856432 3:150258380-150258402 GCTTCTGTATGAAGGAGGACTGG + Intergenic
964858111 3:161169609-161169631 CCTTGCTTCTGAAGGAGGATAGG - Intronic
964988340 3:162772836-162772858 GCTACTATCTGAAGCAGGACAGG + Intergenic
965351889 3:167622743-167622765 GCATCCTGCTGACGTTGGACTGG - Intronic
967078098 3:186023432-186023454 GCTACCTTTTGTAGTAAGACAGG + Intergenic
967851244 3:194084114-194084136 GCTTCCGCCTAAAGTAGGGCTGG + Intergenic
970165762 4:13236380-13236402 ATTTCCTTCAGAAGTAGGACTGG - Intergenic
970858840 4:20678701-20678723 GCTTCCTTTTGAAGTACTGCAGG - Intergenic
972462227 4:39315387-39315409 GCTTCTTTGTGAAGTAGAAGAGG - Intronic
974074674 4:57157644-57157666 GCTTCCTGCTGCAGTGGGACTGG - Intergenic
981027381 4:140090748-140090770 GCTTTCTTCAGAAATTGGACAGG + Intronic
986287739 5:6372403-6372425 CCTTCCTGCTGAGGTGGGACTGG - Exonic
986675387 5:10179616-10179638 GCTTCCTTCAGGAGCAGGTCTGG - Intergenic
987508720 5:18807601-18807623 CCTTCCTTCTGAGGTAGAATAGG + Intergenic
988360768 5:30233630-30233652 CCTTCCTTCTGAAATATGAGGGG - Intergenic
988666735 5:33337228-33337250 GTTTCCTTCTTAAGTAAAACAGG + Intergenic
989989012 5:50739283-50739305 GCTTCCATATGAAGAAGGAGAGG + Intronic
991012305 5:61896875-61896897 GCTTTCTTCTGGAATAGGAAAGG + Intergenic
992934557 5:81688086-81688108 GCTTCCTTCTGGGCCAGGACAGG - Intronic
993251619 5:85531969-85531991 GTTTCATTCTGGAGTAGAACTGG + Intergenic
993393271 5:87348909-87348931 GGTTCCTTCCAAATTAGGACAGG + Intronic
995927602 5:117394160-117394182 GCTTTCTTCTGAATGAGGAGAGG + Intergenic
996447443 5:123572050-123572072 GCCTCAGTCTGAAGTTGGACAGG + Intronic
998541106 5:142982404-142982426 GCTTCCCTCTGGGGCAGGACAGG + Intronic
999011377 5:148044704-148044726 GCTTCCTTCTCAAGAAGGCTTGG + Intronic
999910118 5:156188531-156188553 GCTTCCTGCTGAGGAAGGAAAGG - Intronic
1005067392 6:21831933-21831955 AATTCCTTCTCAAGCAGGACAGG - Intergenic
1005186011 6:23163620-23163642 TCTTCCCTCTGAATTAGAACAGG - Intergenic
1011948157 6:92933663-92933685 GCTGCCATATGAAGTAGGACAGG - Intergenic
1013778499 6:113704790-113704812 GCTTCCTACTGGAGTAGGCCTGG + Intergenic
1018647426 6:165961367-165961389 GCTTCCTTCTGAAGTAGGACAGG - Intronic
1020998196 7:15291856-15291878 GCTTCCTTCTGGAGAAGAAAGGG + Intronic
1023280530 7:38564733-38564755 GCATCCTTCTGAATTAAGAATGG + Intronic
1024378607 7:48668038-48668060 TCTTCCTACTGAAAGAGGACAGG + Intergenic
1024993085 7:55251542-55251564 CCTTCCTTCTTAACTAGTACAGG - Intronic
1025995011 7:66522529-66522551 GTGTCCTTCAGAAGTGGGACTGG + Intergenic
1026244755 7:68609875-68609897 GCTTCCTTCTGTGCTAAGACTGG - Intergenic
1026552106 7:71377533-71377555 GCTTCCCTCAGAAGCAGGGCAGG - Intronic
1027977477 7:85178061-85178083 GCTGCCATGTGAAGAAGGACAGG + Intronic
1028872627 7:95786103-95786125 ACTTTCTTCTGAAGCAGGGCAGG + Intronic
1029349406 7:100002557-100002579 GCCTCCTTTTCAAGTAGTACAGG - Intergenic
1031876000 7:127141478-127141500 GGTTCATTGTGAAGTAGGACTGG - Intronic
1031974354 7:128084517-128084539 TCTGCCTTCAGAAGTGGGACTGG - Intronic
1032495552 7:132359175-132359197 TTTTCCTTCTGAAATAGGAGGGG - Intronic
1035864279 8:3065012-3065034 GCTTCCTTCTCCAGTGGGTCAGG + Intronic
1036017527 8:4801682-4801704 GCTGCCTTGTGTAGAAGGACAGG - Intronic
1039247830 8:35629100-35629122 GCTTGCTACTGAAATAGTACTGG - Intronic
1041005418 8:53493058-53493080 GTTTCCTTCTGAAATTGGAAGGG + Intergenic
1046717082 8:117579676-117579698 TCTTACTTCTAAAATAGGACTGG - Intergenic
1048077382 8:131086503-131086525 GCATCATTCTGAAGTAGGGAGGG - Intergenic
1050161561 9:2724929-2724951 ACCTCCTTCAGAAGTAGCACAGG + Intronic
1051577899 9:18638133-18638155 ACTTTCTTCTGGAGTAGGCCAGG - Intronic
1052042481 9:23754887-23754909 GCTTACTTCTGAACTGGTACAGG - Intronic
1052611612 9:30782760-30782782 TCTACCTTTTGAAGTAGGAAAGG + Intergenic
1057274632 9:93669826-93669848 TCTTGCTTCTGAACCAGGACTGG + Intronic
1058874972 9:109236198-109236220 CCTTGCTTCTGAAGTGGGAAGGG + Intronic
1059425585 9:114219053-114219075 TTTTCCTTTTGAAGTAGGAATGG + Intronic
1061921132 9:133783218-133783240 GCTTCCTCCTGGAGTGGGGCAGG + Intronic
1187290436 X:17948251-17948273 GCCTCCTGATTAAGTAGGACAGG + Intergenic
1188897463 X:35686612-35686634 GCTCCCCTCTGAACCAGGACAGG - Intergenic
1190909260 X:54757134-54757156 GCTGCCTTCTGGTGTAGGCCTGG + Exonic
1192178763 X:68902483-68902505 GCTTCCCTCTGAAGTAGCAAGGG - Intergenic
1192314477 X:70041341-70041363 GCTTCCTACAGGAGTAGGACTGG - Exonic
1192352643 X:70370309-70370331 GCTTACTTCTGGAGGGGGACTGG + Intronic
1193933320 X:87583406-87583428 CCTTCCTTCTGATTTAGGAAAGG + Intronic