ID: 1018651845

View in Genome Browser
Species Human (GRCh38)
Location 6:165998908-165998930
Sequence CACTGGGAATGGAGAGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018651845_1018651856 25 Left 1018651845 6:165998908-165998930 CCTCCTTCTCTCCATTCCCAGTG No data
Right 1018651856 6:165998956-165998978 CTTCCACTGAGACCCCATGGAGG No data
1018651845_1018651855 22 Left 1018651845 6:165998908-165998930 CCTCCTTCTCTCCATTCCCAGTG No data
Right 1018651855 6:165998953-165998975 TTTCTTCCACTGAGACCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018651845 Original CRISPR CACTGGGAATGGAGAGAAGG AGG (reversed) Intergenic
No off target data available for this crispr