ID: 1018652141

View in Genome Browser
Species Human (GRCh38)
Location 6:166001594-166001616
Sequence CTGCAAACTCTGGCGGGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018652141_1018652155 13 Left 1018652141 6:166001594-166001616 CCAGTGCCCGCCAGAGTTTGCAG No data
Right 1018652155 6:166001630-166001652 GAAGACAGGCACAGAGCGAAGGG No data
1018652141_1018652154 12 Left 1018652141 6:166001594-166001616 CCAGTGCCCGCCAGAGTTTGCAG No data
Right 1018652154 6:166001629-166001651 GGAAGACAGGCACAGAGCGAAGG No data
1018652141_1018652152 -9 Left 1018652141 6:166001594-166001616 CCAGTGCCCGCCAGAGTTTGCAG No data
Right 1018652152 6:166001608-166001630 AGTTTGCAGGGTTGGGGGCTGGG No data
1018652141_1018652153 -1 Left 1018652141 6:166001594-166001616 CCAGTGCCCGCCAGAGTTTGCAG No data
Right 1018652153 6:166001616-166001638 GGGTTGGGGGCTGGGAAGACAGG No data
1018652141_1018652151 -10 Left 1018652141 6:166001594-166001616 CCAGTGCCCGCCAGAGTTTGCAG No data
Right 1018652151 6:166001607-166001629 GAGTTTGCAGGGTTGGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018652141 Original CRISPR CTGCAAACTCTGGCGGGCAC TGG (reversed) Intergenic
No off target data available for this crispr