ID: 1018652146

View in Genome Browser
Species Human (GRCh38)
Location 6:166001601-166001623
Sequence CCCAACCCTGCAAACTCTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018652146_1018652153 -8 Left 1018652146 6:166001601-166001623 CCGCCAGAGTTTGCAGGGTTGGG No data
Right 1018652153 6:166001616-166001638 GGGTTGGGGGCTGGGAAGACAGG No data
1018652146_1018652154 5 Left 1018652146 6:166001601-166001623 CCGCCAGAGTTTGCAGGGTTGGG No data
Right 1018652154 6:166001629-166001651 GGAAGACAGGCACAGAGCGAAGG No data
1018652146_1018652155 6 Left 1018652146 6:166001601-166001623 CCGCCAGAGTTTGCAGGGTTGGG No data
Right 1018652155 6:166001630-166001652 GAAGACAGGCACAGAGCGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018652146 Original CRISPR CCCAACCCTGCAAACTCTGG CGG (reversed) Intergenic
No off target data available for this crispr