ID: 1018652150

View in Genome Browser
Species Human (GRCh38)
Location 6:166001604-166001626
Sequence GCCCCCAACCCTGCAAACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018652150_1018652155 3 Left 1018652150 6:166001604-166001626 CCAGAGTTTGCAGGGTTGGGGGC No data
Right 1018652155 6:166001630-166001652 GAAGACAGGCACAGAGCGAAGGG No data
1018652150_1018652154 2 Left 1018652150 6:166001604-166001626 CCAGAGTTTGCAGGGTTGGGGGC No data
Right 1018652154 6:166001629-166001651 GGAAGACAGGCACAGAGCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018652150 Original CRISPR GCCCCCAACCCTGCAAACTC TGG (reversed) Intergenic
No off target data available for this crispr