ID: 1018652150 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:166001604-166001626 |
| Sequence | GCCCCCAACCCTGCAAACTC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1018652150_1018652155 | 3 | Left | 1018652150 | 6:166001604-166001626 | CCAGAGTTTGCAGGGTTGGGGGC | No data | ||
| Right | 1018652155 | 6:166001630-166001652 | GAAGACAGGCACAGAGCGAAGGG | No data | ||||
| 1018652150_1018652154 | 2 | Left | 1018652150 | 6:166001604-166001626 | CCAGAGTTTGCAGGGTTGGGGGC | No data | ||
| Right | 1018652154 | 6:166001629-166001651 | GGAAGACAGGCACAGAGCGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1018652150 | Original CRISPR | GCCCCCAACCCTGCAAACTC TGG (reversed) | Intergenic | ||