ID: 1018652154

View in Genome Browser
Species Human (GRCh38)
Location 6:166001629-166001651
Sequence GGAAGACAGGCACAGAGCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018652144_1018652154 6 Left 1018652144 6:166001600-166001622 CCCGCCAGAGTTTGCAGGGTTGG No data
Right 1018652154 6:166001629-166001651 GGAAGACAGGCACAGAGCGAAGG No data
1018652150_1018652154 2 Left 1018652150 6:166001604-166001626 CCAGAGTTTGCAGGGTTGGGGGC No data
Right 1018652154 6:166001629-166001651 GGAAGACAGGCACAGAGCGAAGG No data
1018652146_1018652154 5 Left 1018652146 6:166001601-166001623 CCGCCAGAGTTTGCAGGGTTGGG No data
Right 1018652154 6:166001629-166001651 GGAAGACAGGCACAGAGCGAAGG No data
1018652141_1018652154 12 Left 1018652141 6:166001594-166001616 CCAGTGCCCGCCAGAGTTTGCAG No data
Right 1018652154 6:166001629-166001651 GGAAGACAGGCACAGAGCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018652154 Original CRISPR GGAAGACAGGCACAGAGCGA AGG Intergenic
No off target data available for this crispr