ID: 1018655249

View in Genome Browser
Species Human (GRCh38)
Location 6:166027789-166027811
Sequence TTGAGTATCCACATCTATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018655249_1018655254 29 Left 1018655249 6:166027789-166027811 CCCAGATAGATGTGGATACTCAA No data
Right 1018655254 6:166027841-166027863 TCTGTTCCTTTCCTGGGTTCAGG No data
1018655249_1018655253 23 Left 1018655249 6:166027789-166027811 CCCAGATAGATGTGGATACTCAA No data
Right 1018655253 6:166027835-166027857 ATGGATTCTGTTCCTTTCCTGGG No data
1018655249_1018655251 4 Left 1018655249 6:166027789-166027811 CCCAGATAGATGTGGATACTCAA No data
Right 1018655251 6:166027816-166027838 CAGTGAGAAAGTCAAAGAAATGG No data
1018655249_1018655252 22 Left 1018655249 6:166027789-166027811 CCCAGATAGATGTGGATACTCAA No data
Right 1018655252 6:166027834-166027856 AATGGATTCTGTTCCTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018655249 Original CRISPR TTGAGTATCCACATCTATCT GGG (reversed) Intergenic
No off target data available for this crispr