ID: 1018656452

View in Genome Browser
Species Human (GRCh38)
Location 6:166041537-166041559
Sequence AGGCCAGTAAGAGCCCCCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018656452_1018656458 24 Left 1018656452 6:166041537-166041559 CCGGTGGGGGCTCTTACTGGCCT No data
Right 1018656458 6:166041584-166041606 ACCCAATGGGACTCATGCAAAGG No data
1018656452_1018656456 10 Left 1018656452 6:166041537-166041559 CCGGTGGGGGCTCTTACTGGCCT No data
Right 1018656456 6:166041570-166041592 TTTGTCTTGTGAGCACCCAATGG No data
1018656452_1018656461 27 Left 1018656452 6:166041537-166041559 CCGGTGGGGGCTCTTACTGGCCT No data
Right 1018656461 6:166041587-166041609 CAATGGGACTCATGCAAAGGAGG No data
1018656452_1018656457 11 Left 1018656452 6:166041537-166041559 CCGGTGGGGGCTCTTACTGGCCT No data
Right 1018656457 6:166041571-166041593 TTGTCTTGTGAGCACCCAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018656452 Original CRISPR AGGCCAGTAAGAGCCCCCAC CGG (reversed) Intergenic
No off target data available for this crispr