ID: 1018657350

View in Genome Browser
Species Human (GRCh38)
Location 6:166051160-166051182
Sequence CCGTATCTTGGATGTGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018657350_1018657356 -3 Left 1018657350 6:166051160-166051182 CCACCACCACATCCAAGATACGG No data
Right 1018657356 6:166051180-166051202 CGGAACTATGAGGCCAGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018657350 Original CRISPR CCGTATCTTGGATGTGGTGG TGG (reversed) Intergenic
No off target data available for this crispr