ID: 1018658691

View in Genome Browser
Species Human (GRCh38)
Location 6:166065082-166065104
Sequence GCATCAGAGGGCTCCCTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 1, 2: 3, 3: 11, 4: 108}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018658680_1018658691 29 Left 1018658680 6:166065030-166065052 CCATCTGGAAAAACCTACCAAAT 0: 2
1: 8
2: 14
3: 49
4: 305
Right 1018658691 6:166065082-166065104 GCATCAGAGGGCTCCCTCTAGGG 0: 1
1: 1
2: 3
3: 11
4: 108
1018658682_1018658691 16 Left 1018658682 6:166065043-166065065 CCTACCAAATATCATGGCATCAA 0: 1
1: 0
2: 0
3: 33
4: 316
Right 1018658691 6:166065082-166065104 GCATCAGAGGGCTCCCTCTAGGG 0: 1
1: 1
2: 3
3: 11
4: 108
1018658683_1018658691 12 Left 1018658683 6:166065047-166065069 CCAAATATCATGGCATCAAGAAG 0: 1
1: 0
2: 16
3: 46
4: 222
Right 1018658691 6:166065082-166065104 GCATCAGAGGGCTCCCTCTAGGG 0: 1
1: 1
2: 3
3: 11
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018658691 Original CRISPR GCATCAGAGGGCTCCCTCTA GGG Intergenic
901678051 1:10898321-10898343 GGGTCAGAGGGCCCCCTCAAGGG + Intergenic
902648185 1:17818685-17818707 TCATCAAAGGCCTCCTTCTAGGG - Intronic
904707483 1:32402303-32402325 GCATCGGAGGCCACCCTCAAGGG - Intergenic
904983521 1:34526066-34526088 GCACGAGAGGGCTGCTTCTAGGG - Intergenic
907089017 1:51707332-51707354 GCACCAGAGGGCCCCCTAAAGGG - Intronic
907834552 1:58096784-58096806 GCATCAGAGCCCTCCATGTATGG - Intronic
909888900 1:80978125-80978147 TCATCAGAGGAATCCCTCTAAGG + Intergenic
910900460 1:92114994-92115016 GCATCAGAGGGGGCCCTCAAGGG - Intronic
910918125 1:92313237-92313259 CCATCAGAGGAATCACTCTATGG + Intronic
913134665 1:115876766-115876788 TCATCTGGGAGCTCCCTCTATGG - Intergenic
913227656 1:116714026-116714048 GCATCAGAGGGCCCCCTCAAGGG - Intergenic
923100250 1:230808654-230808676 GCATCAGAGGGCATCCTGTGTGG + Intergenic
1067090632 10:43264407-43264429 GTATCAGAGGCCCTCCTCTATGG + Intronic
1068338347 10:55667540-55667562 GCATCGGAGGGCCCGCTCAAGGG - Intergenic
1070650673 10:78233301-78233323 GAATCAGACAGCTCACTCTACGG - Intergenic
1083700991 11:64477590-64477612 GCCTCAAAGGGCTCCCTCGATGG + Intergenic
1086581794 11:88408371-88408393 GCATCAGAAGGCCCCTTCAAGGG - Intergenic
1090400928 11:126447720-126447742 GCCTCAGAGTGCTCCTTCCAGGG + Intronic
1090990939 11:131816199-131816221 GCCTCAGAGGTTTCCCTCCATGG - Intronic
1092193928 12:6537851-6537873 GCGTCGGAGGGCCCCCTCAAGGG + Exonic
1092237710 12:6820453-6820475 GCCTGAGAGGGAACCCTCTAAGG + Exonic
1096176713 12:49526078-49526100 GTATCAGAGTGCTCCATCTCAGG + Exonic
1105547122 13:21359103-21359125 GTATCGGAGGGCCCCCTCAAGGG + Intergenic
1105912769 13:24886501-24886523 ACATCAGAGGGATCAGTCTAGGG + Intronic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1106883817 13:34160669-34160691 CCATAAGAGTGGTCCCTCTATGG - Intergenic
1113160094 13:107370222-107370244 GAATCAGAGGGCTTCCTATCCGG + Intronic
1113517489 13:110914762-110914784 GCCTCTGAGGACTCCTTCTATGG - Exonic
1114259234 14:21025347-21025369 GCAGCCGAGGGATCCCTCTCAGG - Intronic
1115469550 14:33754502-33754524 GCCTCAGAGTGCTGGCTCTATGG + Intronic
1116226978 14:42165180-42165202 GTAGCAGAGGCCTTCCTCTAGGG + Intergenic
1116748625 14:48852895-48852917 GCTTCAGAGGGCTCCTTCTCTGG + Intergenic
1119017151 14:71070407-71070429 TCATCAGAGGAATCCCTCTGTGG + Intronic
1119646045 14:76349250-76349272 GCATGCCAGGGCTCCCTCTGTGG + Intronic
1121407139 14:93725976-93725998 GCCACAGAGGGCTCCCTAGATGG + Intronic
1122048644 14:99040731-99040753 CCATCAGAGGGCACCCACGAAGG - Intergenic
1126801556 15:52302789-52302811 GCATCAGAGGCTTCCCACTATGG - Intergenic
1126962241 15:54009987-54010009 CCATCAGAGGCATCCCTCTCTGG + Intergenic
1128458347 15:67846184-67846206 GCTTCAGTGGGCTCGCTCCATGG + Intergenic
1129244118 15:74269444-74269466 GCATCAGAGGGGTGGCTGTAGGG - Intronic
1136656902 16:31714730-31714752 GTAACAAAGGGCTCCCTCCATGG - Intronic
1138816289 16:60206595-60206617 ACAGCAGAGGCCTTCCTCTAAGG - Intergenic
1139301988 16:65953182-65953204 GCACAAGAGGGCTGCCTATAAGG - Intergenic
1141278035 16:82605841-82605863 GCATCAGAGGTCCTCTTCTATGG + Intergenic
1143758193 17:9081758-9081780 GCATGAAAGTGCTTCCTCTATGG - Intronic
1147673762 17:42191354-42191376 GCCTCAGCGGGCTGCCTCTTAGG + Intronic
1150965434 17:69962645-69962667 GCATCACAATGCTCTCTCTAAGG + Intergenic
1153341305 18:3977836-3977858 GCATCAGAGGGGACCCTTGAGGG - Intronic
1155704654 18:28793718-28793740 GCACCAGAGGTCTCCCCCTGGGG + Intergenic
1158206633 18:55000468-55000490 CCATCCTAGGGCTCCTTCTAAGG + Intergenic
1160542571 18:79632903-79632925 CCATCCTAGGGCTCCTTCTAAGG - Intergenic
1162474003 19:10888980-10889002 TCAGTAGGGGGCTCCCTCTAAGG - Intronic
1164460188 19:28440362-28440384 GCACCAGAGGTCACCCTTTAGGG - Intergenic
1164945332 19:32288486-32288508 CAATGAGAGGGCTCCCTCCAGGG - Intergenic
1166067876 19:40370685-40370707 GCAGTAGAGGGCTCCATTTAGGG - Intronic
1167202481 19:48075652-48075674 GCCTCAGAGAGCTCACTCCAAGG - Intronic
924998408 2:384880-384902 GCAAAAGATGGCTCCCTCTCTGG - Intergenic
925418164 2:3688176-3688198 GCATTGGAGGGCCCCCTCAAGGG - Intronic
926350081 2:11986264-11986286 CCATTGGAGGGCTTCCTCTAAGG + Intergenic
930878746 2:56248522-56248544 GCATCCTAGGGCTCCCACTGTGG + Intronic
931973146 2:67612703-67612725 ACATCAGAGGGTTGCCTCTTTGG - Intergenic
937702508 2:124879911-124879933 GCTTCAGAGGGGTCCCTATAAGG - Intronic
941115663 2:161469193-161469215 GCACCACAGGGATGCCTCTAGGG + Intronic
943726358 2:191255725-191255747 GATTCAGAGAGCTGCCTCTATGG + Intronic
948123884 2:235550730-235550752 GCATCAAAGAGCTCACTCTTTGG - Intronic
948585812 2:239019011-239019033 GCATCTGGGGGTTCCCTCTTGGG + Intergenic
948787646 2:240361139-240361161 GCATCTGAAGGCGCCCTCCACGG + Intergenic
1168889338 20:1284117-1284139 GCACCAGAGGGTCCCCTCTAAGG - Intronic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1179512735 21:41884639-41884661 GAAGCATCGGGCTCCCTCTAAGG + Intergenic
1179908334 21:44435489-44435511 CCATTAGAGGGCACCCTCCACGG + Intronic
1182430986 22:30298825-30298847 ACAACAGAGGGCACCCTCTCTGG + Intronic
951538584 3:23761610-23761632 CCATCCCAGTGCTCCCTCTATGG + Intergenic
951682760 3:25311607-25311629 GCAGCTGAGGGCTTCCTCAAAGG + Intronic
953420507 3:42750130-42750152 CCATTCAAGGGCTCCCTCTATGG + Intronic
953856772 3:46505350-46505372 GCATCCTAGTGCTCCCTCTAGGG + Intergenic
955126518 3:56117583-56117605 GGATAAGAGGACTCCCTCAAGGG + Intronic
959820740 3:110732356-110732378 TCATCAGATGTCTGCCTCTAGGG + Intergenic
960275246 3:115721645-115721667 GCAACAGATGTCTCCCTCGAGGG - Intergenic
960706592 3:120488431-120488453 GCTTCAGATGGCTTCCTCTCAGG - Intergenic
960913865 3:122678336-122678358 CCATCAGGGGGCTCCCTCTGAGG + Intergenic
969219377 4:5749679-5749701 GCATCAGAGGGCTCGTTCCCTGG - Intronic
970379518 4:15492917-15492939 GCATCAGAGGGCCCCCTCAAGGG - Intronic
976628051 4:87207877-87207899 ACATCGGAGGGCCCCCTCAAGGG + Intronic
977256142 4:94742075-94742097 GCCACACAGGGCTACCTCTAGGG + Intergenic
977291384 4:95168565-95168587 GCACCAGAAGGGTCCCTCCAAGG + Exonic
981200765 4:141976916-141976938 CCATAAGAGGAATCCCTCTATGG - Intergenic
981250860 4:142598884-142598906 GAATCAGAGGGCTGCCTGTTTGG + Intronic
982220768 4:153123373-153123395 TGATCAGAGGGCACCTTCTAGGG + Intergenic
990575407 5:57119100-57119122 GGTTCAGAGAGCTCCCTCAATGG + Intergenic
996828261 5:127709939-127709961 CCATGAGAGGGTTACCTCTAGGG - Intergenic
996942408 5:129024181-129024203 CCATCTGAGTGATCCCTCTAGGG - Intronic
998393992 5:141806524-141806546 GCTACAGAGGACTCCCTCCAGGG - Intergenic
999751093 5:154628692-154628714 GAATCAGAGGGGTCCCCCTTGGG - Intergenic
1000351997 5:160359514-160359536 GCATCAGAGAGATTTCTCTATGG - Intronic
1002232940 5:177782236-177782258 GCCTCAGAGGGCACCCTCAGAGG - Exonic
1006176275 6:32123833-32123855 GCATCAGCGGGCTCCCTGGTTGG + Intronic
1007094112 6:39202854-39202876 GAATCAGAGGGGTCTCTCGATGG + Intronic
1010781829 6:79953198-79953220 GCATCAGAGGGCCCCCTCAAAGG - Intergenic
1011071809 6:83393195-83393217 GCGTCAGAGGACCCCCTCAAAGG + Intronic
1017911674 6:158798574-158798596 GCTTCAGAGACCTCCCTCGATGG + Intronic
1018658691 6:166065082-166065104 GCATCAGAGGGCTCCCTCTAGGG + Intergenic
1020551778 7:9615770-9615792 GCATCAGAGGGCTCCCTCAAGGG + Intergenic
1022965371 7:35466975-35466997 CCCTCAGAGGTCTGCCTCTATGG - Intergenic
1036236578 8:7044123-7044145 GCCCCAGAGAGCTCCCTCTCTGG + Intergenic
1041350904 8:56946955-56946977 GGGTCAGAGGGCTGCCTCTGAGG - Intergenic
1046561987 8:115849337-115849359 ACATCAGAGGCTTCCATCTATGG - Intergenic
1048067407 8:130984203-130984225 GCATGAGTGGGCTCCCTGTGGGG + Intronic
1048067416 8:130984239-130984261 GCATGAGTGGGCTCCCTGTGGGG + Intronic
1055239312 9:74164387-74164409 GCATCAGGAGGCTCCCCCTCTGG + Intergenic
1056115098 9:83434028-83434050 GCAGCAGAGGGCTTCCTGTCTGG + Intronic
1057297786 9:93859593-93859615 GCTTGAGGTGGCTCCCTCTAGGG - Intergenic
1059634868 9:116160599-116160621 GTACTAGAGGACTCCCTCTATGG + Intronic
1061264783 9:129498504-129498526 GCATCAGAGGCCCACCTCTCTGG - Intergenic
1062351958 9:136143706-136143728 GCAATAAAGGGCTCCCTCCAGGG - Intergenic
1062684110 9:137801173-137801195 CCAGCAGAGGCCACCCTCTAGGG + Intronic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1190710281 X:53063082-53063104 ACTGCAGAGGGCTCCCACTAAGG - Intronic
1192416915 X:70989150-70989172 CCATCAGAAAGTTCCCTCTACGG - Intergenic
1194775085 X:97953416-97953438 GCATCAGAAGCCTCTCACTAGGG + Intergenic
1195128543 X:101832329-101832351 ACATCAAAGGGCTCCTTTTAGGG + Intronic
1195467156 X:105192061-105192083 GCACCAGTTGGCTCCCTCTATGG + Intronic
1196184027 X:112726141-112726163 GCAACAGATGGCTGCATCTAGGG + Intergenic
1198336911 X:135675329-135675351 GCATCAGTGGGCTATCCCTATGG - Intergenic