ID: 1018659195

View in Genome Browser
Species Human (GRCh38)
Location 6:166069541-166069563
Sequence GATCCCTCCCCCAACAAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018659195_1018659203 7 Left 1018659195 6:166069541-166069563 CCCCACTTGTTGGGGGAGGGATC No data
Right 1018659203 6:166069571-166069593 GGTGATTAGATAGATCATGGGGG No data
1018659195_1018659200 4 Left 1018659195 6:166069541-166069563 CCCCACTTGTTGGGGGAGGGATC No data
Right 1018659200 6:166069568-166069590 GGAGGTGATTAGATAGATCATGG No data
1018659195_1018659201 5 Left 1018659195 6:166069541-166069563 CCCCACTTGTTGGGGGAGGGATC No data
Right 1018659201 6:166069569-166069591 GAGGTGATTAGATAGATCATGGG No data
1018659195_1018659202 6 Left 1018659195 6:166069541-166069563 CCCCACTTGTTGGGGGAGGGATC No data
Right 1018659202 6:166069570-166069592 AGGTGATTAGATAGATCATGGGG No data
1018659195_1018659204 10 Left 1018659195 6:166069541-166069563 CCCCACTTGTTGGGGGAGGGATC No data
Right 1018659204 6:166069574-166069596 GATTAGATAGATCATGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018659195 Original CRISPR GATCCCTCCCCCAACAAGTG GGG (reversed) Intergenic
No off target data available for this crispr