ID: 1018659639

View in Genome Browser
Species Human (GRCh38)
Location 6:166074033-166074055
Sequence ACGGCTCCTCCACCTGTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018659639_1018659650 29 Left 1018659639 6:166074033-166074055 CCAGGGACAGGTGGAGGAGCCGT No data
Right 1018659650 6:166074085-166074107 GACCATCGGGCTTCCGAGGCAGG No data
1018659639_1018659649 25 Left 1018659639 6:166074033-166074055 CCAGGGACAGGTGGAGGAGCCGT No data
Right 1018659649 6:166074081-166074103 GGGAGACCATCGGGCTTCCGAGG No data
1018659639_1018659644 5 Left 1018659639 6:166074033-166074055 CCAGGGACAGGTGGAGGAGCCGT No data
Right 1018659644 6:166074061-166074083 CAGGTGCTCAGCTGACACCCGGG No data
1018659639_1018659645 15 Left 1018659639 6:166074033-166074055 CCAGGGACAGGTGGAGGAGCCGT No data
Right 1018659645 6:166074071-166074093 GCTGACACCCGGGAGACCATCGG No data
1018659639_1018659643 4 Left 1018659639 6:166074033-166074055 CCAGGGACAGGTGGAGGAGCCGT No data
Right 1018659643 6:166074060-166074082 CCAGGTGCTCAGCTGACACCCGG No data
1018659639_1018659646 16 Left 1018659639 6:166074033-166074055 CCAGGGACAGGTGGAGGAGCCGT No data
Right 1018659646 6:166074072-166074094 CTGACACCCGGGAGACCATCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018659639 Original CRISPR ACGGCTCCTCCACCTGTCCC TGG (reversed) Intergenic
No off target data available for this crispr