ID: 1018660388

View in Genome Browser
Species Human (GRCh38)
Location 6:166080730-166080752
Sequence CTCGCTGCTCAGGGAGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018660388_1018660391 3 Left 1018660388 6:166080730-166080752 CCTTTCTCTCCCTGAGCAGCGAG No data
Right 1018660391 6:166080756-166080778 GCTGCCAGTAGAAGTGACCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018660388 Original CRISPR CTCGCTGCTCAGGGAGAGAA AGG (reversed) Intergenic
No off target data available for this crispr