ID: 1018662754

View in Genome Browser
Species Human (GRCh38)
Location 6:166103344-166103366
Sequence GTGCACTGCTCAGGATCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018662749_1018662754 24 Left 1018662749 6:166103297-166103319 CCCAGAAATGGTCCAACTTCAAG No data
Right 1018662754 6:166103344-166103366 GTGCACTGCTCAGGATCACAAGG No data
1018662752_1018662754 12 Left 1018662752 6:166103309-166103331 CCAACTTCAAGGTCTTGCAGTAT No data
Right 1018662754 6:166103344-166103366 GTGCACTGCTCAGGATCACAAGG No data
1018662750_1018662754 23 Left 1018662750 6:166103298-166103320 CCAGAAATGGTCCAACTTCAAGG No data
Right 1018662754 6:166103344-166103366 GTGCACTGCTCAGGATCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018662754 Original CRISPR GTGCACTGCTCAGGATCACA AGG Intergenic
No off target data available for this crispr