ID: 1018663550

View in Genome Browser
Species Human (GRCh38)
Location 6:166112770-166112792
Sequence CGGGTGACTCATAGCTTACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 38}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018663547_1018663550 -3 Left 1018663547 6:166112750-166112772 CCGTGAACATTTTGTCAGCACGG 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1018663550 6:166112770-166112792 CGGGTGACTCATAGCTTACACGG 0: 1
1: 0
2: 0
3: 7
4: 38
1018663545_1018663550 16 Left 1018663545 6:166112731-166112753 CCTTGGGCTCTGCACACCACCGT 0: 1
1: 0
2: 1
3: 16
4: 157
Right 1018663550 6:166112770-166112792 CGGGTGACTCATAGCTTACACGG 0: 1
1: 0
2: 0
3: 7
4: 38
1018663546_1018663550 0 Left 1018663546 6:166112747-166112769 CCACCGTGAACATTTTGTCAGCA 0: 1
1: 0
2: 0
3: 3
4: 88
Right 1018663550 6:166112770-166112792 CGGGTGACTCATAGCTTACACGG 0: 1
1: 0
2: 0
3: 7
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018663550 Original CRISPR CGGGTGACTCATAGCTTACA CGG Intergenic
903295050 1:22338466-22338488 AGGGTGCCTCAGAGCTCACAGGG + Intergenic
909192470 1:72572068-72572090 GGAGTAACTCATATCTTACATGG - Intergenic
1070653707 10:78256280-78256302 ATGCTGACTCATAGCTCACAAGG - Intergenic
1073235511 10:102011931-102011953 CAGGTGACTCTTAGCTTGCAGGG - Intronic
1087713611 11:101582919-101582941 CGGGTGACTCTTAGCCTATGTGG - Intronic
1088693526 11:112347478-112347500 AGGATGACTCCTATCTTACAAGG + Intergenic
1093099488 12:15010681-15010703 CTGCTGAATCACAGCTTACAGGG - Intergenic
1095252989 12:40000128-40000150 AGGGTAAGTCATGGCTTACATGG - Intronic
1099723142 12:86390115-86390137 CGGTTGACCCACAGCTTATAGGG + Intronic
1141728254 16:85804882-85804904 GGGGTGACTCTCAACTTACATGG + Intronic
1144413752 17:15025817-15025839 CGGGTGACTCAAAGCAAAGAGGG - Intergenic
1150559295 17:66281017-66281039 CGGGTGACCCTGAGGTTACAGGG + Intergenic
1152997558 18:422094-422116 CTGGTGACTCTTACCTTACAGGG - Intronic
1156558825 18:38098500-38098522 CGTGTCACTCATACCTTAAATGG + Intergenic
1160237454 18:77097372-77097394 CAGGTGACTGATAGCTGAGAGGG - Intronic
1164731870 19:30511757-30511779 GGGGTGGCTCAGAGCTTACATGG + Intronic
925135073 2:1521434-1521456 CCGGTCACCCATGGCTTACAGGG - Intronic
926117994 2:10225391-10225413 CGGGTCACGCTGAGCTTACAGGG - Intergenic
941923603 2:170874761-170874783 AGGGTGACTCAAAAGTTACATGG + Intergenic
947475794 2:230446706-230446728 TGGGTGACTCAGAGCTCAGAGGG - Intronic
948884663 2:240876744-240876766 CGGGTGGCATTTAGCTTACAGGG - Intronic
1173388639 20:42611627-42611649 CGTGTGACTCATTGCTGAGATGG + Intronic
1173627681 20:44485507-44485529 CCGGTGCCCCATAGTTTACAAGG - Intronic
1175170925 20:57081053-57081075 CAGGTGACTCATATCTGACCTGG - Intergenic
1181524144 22:23469479-23469501 CTGTTGACTCCTAGCTTAAAGGG - Intergenic
962232850 3:133681173-133681195 TCGGTGACTCAAAGCTTACATGG - Intergenic
974580249 4:63789792-63789814 CGGGGAACTAATAACTTACATGG + Intergenic
990358724 5:54996678-54996700 CGTGTGACTCATCTCATACAAGG - Intronic
1007803260 6:44416283-44416305 GGAGTGAGTCATAGCTTACAGGG + Intronic
1008932240 6:56953874-56953896 CGAGTGACTCATGACTTACCTGG + Intronic
1010407874 6:75525835-75525857 GGGGTGACTTTTTGCTTACAGGG - Intergenic
1018663550 6:166112770-166112792 CGGGTGACTCATAGCTTACACGG + Intergenic
1030013931 7:105199571-105199593 CTGGTGATTCATACCATACAGGG + Intronic
1033067932 7:138173752-138173774 CAGGTGAATCACAGCTTACTAGG + Intergenic
1034254784 7:149718932-149718954 CTGGTGACCCAAAGCTTCCAAGG + Intronic
1038024023 8:23573232-23573254 CGGGTGACGCAGAGCAGACAAGG - Exonic
1043870235 8:85424228-85424250 GGGCGGACTGATAGCTTACACGG - Intronic
1047600060 8:126417156-126417178 CAGGAGACTCATAGAATACAAGG + Intergenic
1048906302 8:139092753-139092775 CGGGTGGGTCACGGCTTACAAGG + Intergenic
1049102030 8:140586908-140586930 TCGGTGACTCCCAGCTTACAAGG + Intronic
1052701474 9:31942368-31942390 GGAGTGATTCACAGCTTACATGG - Intergenic
1054854840 9:69887802-69887824 CTGGTGGCTCAGAGCTTAAAAGG - Intronic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1186871697 X:13780233-13780255 CGGGTCACTCTTAACTAACAAGG + Intronic
1189883499 X:45515730-45515752 CGAGTGACTCACATCTTACAGGG + Intergenic
1192068408 X:67911148-67911170 TGGCTGACTCACAGCTTACAAGG - Intergenic