ID: 1018664527

View in Genome Browser
Species Human (GRCh38)
Location 6:166122927-166122949
Sequence AAACCCTGCTTCACAAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018664526_1018664527 20 Left 1018664526 6:166122884-166122906 CCAGGCTACTCTGTAATCTCATT No data
Right 1018664527 6:166122927-166122949 AAACCCTGCTTCACAAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018664527 Original CRISPR AAACCCTGCTTCACAAAGAC AGG Intergenic