ID: 1018668352

View in Genome Browser
Species Human (GRCh38)
Location 6:166160229-166160251
Sequence CAAGTTATGCAGAGGGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 295}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018668352 Original CRISPR CAAGTTATGCAGAGGGAAAA AGG (reversed) Intronic
905940293 1:41857732-41857754 AAAGTCATGCAGAAGGAAAGAGG + Intronic
907131740 1:52103364-52103386 CAGGGTATGCTAAGGGAAAAGGG - Intergenic
907815758 1:57916975-57916997 AAAGTTATGCAGAAGGTAAATGG + Intronic
916360242 1:163959769-163959791 CAGTTTCTGCAGGGGGAAAAGGG - Intergenic
919217553 1:194578836-194578858 CAAGTTATGCTAAAGGAAATTGG - Intergenic
920430014 1:205912736-205912758 AAAGGTATGCAGAGGGATGATGG + Intergenic
921630776 1:217431218-217431240 CAAGCCATGCAGAGGCCAAAGGG - Exonic
922019737 1:221691655-221691677 CATGTTATGGATAGGGAAACAGG - Intergenic
922090352 1:222389790-222389812 TAAGTAATTTAGAGGGAAAATGG + Intergenic
922771073 1:228183281-228183303 AAAGTTGGGCAGAGGGAACAAGG - Intergenic
923497192 1:234535904-234535926 CAAGCTCTGCAGAGGGCAACTGG + Intergenic
923519415 1:234724507-234724529 CATGTTTGGCAGAGGGAAAGAGG - Intergenic
924017793 1:239746453-239746475 TAAGTTAAGCAGAGGTAAAATGG - Intronic
1062884696 10:1007318-1007340 CACGTCATGCAGTGGGAAACGGG - Intronic
1063479937 10:6366590-6366612 CACCTTATGCAGAGGGAGAAGGG - Intergenic
1063730154 10:8687344-8687366 CATGTTATGCATAGGAAGAAAGG + Intergenic
1064472721 10:15653413-15653435 CAAGTTAGGGAGAGGGTAATGGG - Intronic
1065733681 10:28732190-28732212 TAAGTCCTGCAGAGGGAAATAGG + Intergenic
1065934928 10:30512851-30512873 CAAATTATGCCAGGGGAAAAGGG - Intergenic
1067982849 10:51106667-51106689 CAAGTCTTCCAGAGGTAAAAAGG - Intronic
1068088834 10:52407941-52407963 CAAGGTATGCACAGAGGAAAAGG - Intergenic
1069112763 10:64467548-64467570 CCAGGTATGTAGAGGGAAAGGGG + Intergenic
1071295768 10:84218124-84218146 CAAGGGATGGAGAGGGAGAATGG + Intronic
1071295881 10:84219309-84219331 AAATTTAGGGAGAGGGAAAATGG - Intronic
1071351115 10:84746318-84746340 CAAATTATACAGAGAGAAAATGG - Intergenic
1071908157 10:90197983-90198005 AGAGTCATGCAGAGGGAAAGTGG + Intergenic
1072029168 10:91500939-91500961 AAAGTTATGCAGGAGAAAAATGG + Intronic
1072141715 10:92594701-92594723 AAAGGGATGGAGAGGGAAAAGGG - Intronic
1072704811 10:97673564-97673586 TAAGATCTGCAGTGGGAAAAAGG - Exonic
1073002368 10:100295144-100295166 CAAGGGATGAAGAAGGAAAAGGG + Intronic
1074196874 10:111196608-111196630 CATGTTCTGCAGAAGGCAAATGG + Intergenic
1075079735 10:119375332-119375354 CAGGTGAAGAAGAGGGAAAAAGG - Intronic
1075406207 10:122197451-122197473 GAAGTTAGGCAGAAGGAAGAAGG - Intronic
1076145901 10:128120861-128120883 AAAGTTATTCATAGAGAAAAAGG + Intronic
1081343243 11:41952970-41952992 CAATTTTCTCAGAGGGAAAAAGG + Intergenic
1081367199 11:42250012-42250034 CAAGATATTCAGTGGAAAAATGG - Intergenic
1082072591 11:47950994-47951016 CAAATAATCCTGAGGGAAAAAGG - Intergenic
1083514124 11:63240743-63240765 CAAGATGTGAAGATGGAAAATGG - Intronic
1084699944 11:70779981-70780003 CAAGTCCTGCAGAAAGAAAATGG - Intronic
1084737236 11:71113412-71113434 AGAGTTGTTCAGAGGGAAAACGG + Intronic
1085056409 11:73406739-73406761 CCAGATCTGCAGAGGGAAAGGGG + Exonic
1085673192 11:78488888-78488910 GAAGTTATCCAGAGGTAGAAAGG + Intronic
1087315217 11:96594419-96594441 CAAGTCATGCAAAAGGATAATGG - Intergenic
1087877874 11:103379629-103379651 CAAGTTATGGAGGGGAAAAAAGG - Intronic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1092119554 12:6034478-6034500 CCAGGTGAGCAGAGGGAAAATGG + Intronic
1092148718 12:6232539-6232561 GGAGTTAGGCAGAGGGAAACAGG + Intronic
1092157673 12:6294988-6295010 CTAGTTATGCAGAGGGAACAGGG + Intergenic
1093176208 12:15916135-15916157 CAATTTATCCTGAGGGAGAATGG + Intronic
1095129504 12:38522597-38522619 CAAGAAATGGAGAGGTAAAAAGG + Intergenic
1096729082 12:53591916-53591938 CAAGTTTTTCAAAGGCAAAAAGG + Intronic
1100107486 12:91193668-91193690 CAGGCTATGCAGAGGGAAGTGGG - Intergenic
1100161469 12:91865529-91865551 AGAGTTAAGCATAGGGAAAAGGG + Intergenic
1100224617 12:92543531-92543553 CAAGTAATCCAGAGGGAATAAGG - Intergenic
1100286746 12:93173907-93173929 CAAGTTATTCAGGAGGTAAAAGG + Intergenic
1101039949 12:100745314-100745336 CAAAATATGCTGAGGCAAAAAGG - Intronic
1102164455 12:110795317-110795339 CATGTTATGGATAGGGAAACAGG + Intergenic
1102899569 12:116625866-116625888 CAAGTTAAAAACAGGGAAAATGG - Intergenic
1104038953 12:125116935-125116957 CAAGAAAGGCAAAGGGAAAAAGG - Intronic
1105961877 13:25349252-25349274 TAAATAATGCAGTGGGAAAAGGG + Intronic
1105985401 13:25561278-25561300 CAAGAGATGCAGAGGGAACAGGG - Intronic
1106002114 13:25733889-25733911 GAAGTTAGGCAGAAGAAAAAAGG - Intronic
1106171761 13:27294739-27294761 AGAGATATGCAGAGGGAAGATGG + Intergenic
1107374436 13:39786554-39786576 CAAGGTTTGCAGAGAGAAAATGG + Intronic
1109602892 13:64656526-64656548 AAAGTTGTGGAGAGAGAAAAGGG + Intergenic
1110691555 13:78435371-78435393 CAAATGATGCAGTGAGAAAAAGG + Intergenic
1111324252 13:86671049-86671071 CAAGTGAAGCATAGGGAAAATGG + Intergenic
1111337760 13:86845718-86845740 TATGTTATGCTGAGGGAACATGG + Intergenic
1111392145 13:87610379-87610401 CAAGTTATCCAGAAGGCACAAGG - Intergenic
1111698025 13:91649986-91650008 GAAGTTGTGTAGAGGGATAATGG - Intronic
1112283277 13:98081383-98081405 CAGTTTATGCAGAGGTAAACTGG - Intergenic
1113440000 13:110321415-110321437 CAAGTTCTGGAGACGGACAATGG - Intronic
1115430476 14:33311909-33311931 CAAGGCATGGAGAGGGAAATAGG + Intronic
1115910701 14:38254541-38254563 CTAGTGATGCATAGGGAAACAGG - Exonic
1116018287 14:39432222-39432244 CAAGTTGTGGAGAGGGGGAAAGG + Exonic
1116030791 14:39568755-39568777 CACATTTTGCAGAGGGAGAAGGG + Intergenic
1116149929 14:41128102-41128124 CAAGCTATGCAGCCGTAAAAGGG - Intergenic
1116255756 14:42552778-42552800 CAGATTATACAGAGTGAAAAGGG - Intergenic
1118302768 14:64629963-64629985 CATATTATTTAGAGGGAAAAAGG - Intergenic
1118758911 14:68865905-68865927 CAAGTCTGGCAGAGAGAAAAAGG - Intergenic
1119052904 14:71387671-71387693 CAACTTCTGCAGAGGTGAAATGG - Intronic
1119530807 14:75359803-75359825 CAAATTGTGAAGAGGGAGAAGGG + Intergenic
1120649557 14:87115421-87115443 CAGGGAAAGCAGAGGGAAAAGGG - Intergenic
1122167388 14:99838536-99838558 AAAATTATGCAGATGGAGAAGGG - Intronic
1122254883 14:100469246-100469268 CAGGAGACGCAGAGGGAAAATGG + Intronic
1123470301 15:20546254-20546276 GAAATGATTCAGAGGGAAAAAGG + Intergenic
1123647754 15:22454446-22454468 GAAATGATTCAGAGGGAAAAAGG - Intergenic
1123696701 15:22883892-22883914 ACAGTTATGCAGAAGGTAAAGGG + Intronic
1123830982 15:24136879-24136901 CAGGGTATGCAGAAGGAACATGG + Intergenic
1123836064 15:24194254-24194276 CAGGGTATGCAGAAGGAACATGG + Intergenic
1124032987 15:26028179-26028201 CAAATTCTGCAAAGGAAAAATGG + Intergenic
1124281113 15:28362540-28362562 GAAATGATTCAGAGGGAAAAAGG + Intergenic
1124301590 15:28549081-28549103 GAAATGATTCAGAGGGAAAAAGG - Intergenic
1124662804 15:31563794-31563816 CCAGCTATGCAGAGGGGAACAGG + Intronic
1124849364 15:33321429-33321451 CATGGAAAGCAGAGGGAAAAAGG - Intronic
1124872318 15:33555320-33555342 CAAGTTATCCACTGGGGAAAGGG + Intronic
1125462622 15:39920785-39920807 CCAGCCATGCAGAGGCAAAAAGG - Exonic
1126150218 15:45517175-45517197 GAAGTCAGGCAGAGGGAAAAAGG - Intronic
1126261985 15:46704123-46704145 CAAGGTATGCAGAGGTCACATGG - Intergenic
1126685433 15:51244887-51244909 TAAGTTATGCAAAGAGAAGAAGG + Intronic
1126946497 15:53827537-53827559 CAACTGATGACGAGGGAAAACGG - Intergenic
1127460647 15:59195404-59195426 CATCTTGAGCAGAGGGAAAAAGG + Intronic
1130141873 15:81233783-81233805 CAAGCTATTCATAGGGGAAATGG - Intronic
1130759229 15:86800547-86800569 CCAGTTATGCAAAGTGAGAAAGG - Intronic
1131090777 15:89623461-89623483 CATGTTTTGGAGAGGGAAACGGG + Intronic
1132052683 15:98620690-98620712 CAAGTTATGAGGAATGAAAAAGG + Intergenic
1133997088 16:10756673-10756695 CACGTACTGCAGAGGGAACAGGG - Exonic
1135325636 16:21523745-21523767 CAATGTGTGCAGAGGGAACACGG + Intergenic
1135497562 16:22965716-22965738 CAAGTGTTACAAAGGGAAAATGG + Intergenic
1135615571 16:23908222-23908244 ACAGTGCTGCAGAGGGAAAAAGG + Intronic
1135617587 16:23925322-23925344 CAAGTCCTGCAGAATGAAAAGGG - Intronic
1135824473 16:25714387-25714409 GAAGTTATCCAGAGTGAACACGG + Intronic
1136510834 16:30737464-30737486 CAAGATATGGACAGGGAGAATGG - Exonic
1137913681 16:52405106-52405128 CAAATTGTACAGAGGAAAAATGG + Intergenic
1139255326 16:65535578-65535600 CATGTTATAGAGAGGGAAACTGG - Intergenic
1139446923 16:67003743-67003765 CAAGGAATGGAGAGGGTAAAGGG + Intronic
1139541467 16:67620548-67620570 CAAATAATGAAGAGGGAAGAAGG + Intronic
1140114459 16:72029495-72029517 CGAGATTTGCAGAGGCAAAAGGG + Intergenic
1141421085 16:83915948-83915970 CATGCAATGCAGAGGGACAAAGG + Exonic
1143058125 17:4177639-4177661 AAACTCATGGAGAGGGAAAATGG + Intronic
1143964965 17:10750508-10750530 CAAGTTGTGTAGAGGGAACCAGG - Intergenic
1144072948 17:11690595-11690617 AAAGTTAGGCAGAGGAAAAGAGG + Intronic
1144942997 17:18954251-18954273 CAAGATCTGAAGAGGGAAAGAGG + Intronic
1145044187 17:19599824-19599846 CTAGTTATGCAGAAGGTATAAGG - Intergenic
1145813586 17:27780195-27780217 CATGTCATGCAAAGGGAACAGGG + Intronic
1145821040 17:27835780-27835802 CAAGGTTTGCAGTGGGAGAAAGG - Intronic
1145987435 17:29056471-29056493 CAAGTGAGGCAGAAGAAAAAGGG - Exonic
1148966828 17:51442793-51442815 CTAGAAATGCAGAGGGAAACGGG - Intergenic
1149123694 17:53201781-53201803 CATAATATGTAGAGGGAAAATGG + Intergenic
1150700664 17:67444313-67444335 CAAGTTATGAAGGAGGAATACGG + Intronic
1153015773 18:581177-581199 CAAGTTCAGCACAGGGCAAATGG - Exonic
1153230808 18:2933803-2933825 GAAGTAATTCAAAGGGAAAATGG + Intronic
1153307500 18:3645577-3645599 CAAGCTATGCAGAGGCAAACAGG - Intronic
1153437409 18:5082493-5082515 AAAGTTACGCAGCTGGAAAATGG + Intergenic
1154138252 18:11799948-11799970 AAAGGAATGGAGAGGGAAAAAGG - Intronic
1159051713 18:63426613-63426635 CAAGGGATGCAGAGCCAAAAGGG + Intergenic
1159511173 18:69400578-69400600 CAAGCTGTGCAGCGGGGAAAGGG - Intergenic
1164480109 19:28605018-28605040 CAAGTGCTGCAGTGGGGAAATGG + Intergenic
1166163976 19:40973634-40973656 CAAGTTCAAGAGAGGGAAAATGG + Intergenic
1166238222 19:41471873-41471895 CACAATATTCAGAGGGAAAAAGG - Intergenic
1166975569 19:46603233-46603255 CAGGTTCTGCTGGGGGAAAATGG - Intronic
1167527347 19:49993220-49993242 CAAACTCAGCAGAGGGAAAAGGG + Intronic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
927095028 2:19741642-19741664 AAAGTTCTTCAAAGGGAAAATGG + Intergenic
927144193 2:20150745-20150767 CATGTTATGCACACAGAAAAGGG - Intergenic
927270794 2:21208303-21208325 CAGGTTATTCAGAGGCAACATGG + Intergenic
928601548 2:32908653-32908675 CAAGTTATGGAGAAGGGGAATGG - Intergenic
929603182 2:43217717-43217739 CATGTTATGCAGATGGAAGTCGG - Intergenic
929785209 2:44984840-44984862 CAAGCTATGCCAAGGGAAGAGGG + Intergenic
930268393 2:49227107-49227129 CAAATTTGGCAGAGGTAAAAAGG + Intergenic
931223057 2:60305765-60305787 CAAGTTTTTCAGAGGGGAGATGG + Intergenic
931283493 2:60813858-60813880 CAAGTTAAGAAGAGGAACAAAGG + Intergenic
931561522 2:63566961-63566983 CAAGAGATGCACAGGGCAAATGG + Intronic
933462515 2:82607016-82607038 AAAGTTATGCAGAAGCAAACAGG - Intergenic
935484852 2:103640535-103640557 AAAGTCAAGCAGAGGGAAAAGGG + Intergenic
937829277 2:126402195-126402217 CAAATTATGCAGAGGGTCGATGG + Intergenic
938696069 2:133836768-133836790 AAAGGTATCCAGAAGGAAAAGGG - Intergenic
940169446 2:150811833-150811855 GAAGTTAAGAAGAGTGAAAAAGG - Intergenic
940281088 2:151990330-151990352 GAAGTTATGCACAGGGAATTAGG - Intronic
942198139 2:173543322-173543344 CATGTTATGGAAAGGGAAGAGGG - Intergenic
942422722 2:175824563-175824585 CAAGTTATGCCAAGAGTAAATGG + Intergenic
943101485 2:183492261-183492283 AAAGTGATACAGAGGTAAAATGG - Intergenic
943313895 2:186361529-186361551 AAAAGTATGCAGAGGGAAAGAGG + Intergenic
944398635 2:199299549-199299571 CAAGGTAGCCAGAGGGAAAATGG + Intronic
944462584 2:199966647-199966669 CAAGTTCAGAAGAGGGGAAAGGG - Intronic
945276639 2:207994399-207994421 ACAGTGATGCAGAGGGAAAAGGG + Intronic
946123112 2:217533772-217533794 CAAGTAAGGCAGAGAGAAAAGGG + Intronic
948785285 2:240349107-240349129 CAAGTTTTGCAGGATGAAAAGGG + Intergenic
1169273825 20:4219985-4220007 CAAGTTTTACAGAGTTAAAAAGG - Intergenic
1170295164 20:14816517-14816539 CAATTTATACAGATGAAAAATGG - Intronic
1172620932 20:36318209-36318231 CAGGTTAGGCAGAGTGATAAGGG + Intronic
1173361515 20:42348880-42348902 CAAATTATGAGGAGGGATAAGGG - Intronic
1174940765 20:54924034-54924056 AAGGGTATGAAGAGGGAAAAGGG + Intergenic
1175638188 20:60602972-60602994 CAAGTTGTGCAAAGGGACATGGG - Intergenic
1176254434 20:64143601-64143623 CCAGCTCTGCAGAGGGAACATGG - Intergenic
1177298279 21:19205238-19205260 CAACATATGCAGAGGTAAAGCGG - Intergenic
1177321843 21:19532078-19532100 GAAGTTATGTAGAATGAAAAAGG + Intergenic
1179374689 21:40839898-40839920 CAAGATATGAAGAAGGAAAGAGG - Intronic
1180241996 21:46515219-46515241 CAAGTAAGGCAGTGGGACAAGGG + Intronic
1183211193 22:36452460-36452482 CAATTGATTCAGAGGGTAAAGGG - Intergenic
949440813 3:4078231-4078253 CAAACTATGCAGATGGAAATGGG + Intronic
950306620 3:11919716-11919738 CAAGATGTGAAGTGGGAAAAAGG + Intergenic
950327932 3:12130307-12130329 CAAGATCTGCAGTGGGCAAATGG + Intronic
950873628 3:16250420-16250442 CAAGTGATGCACAGAGAAATGGG - Intergenic
950956288 3:17056908-17056930 TAAGTTAAGCAGAAGGAACAGGG + Intronic
951437399 3:22680605-22680627 CAGGTTATACAGAGTGACAAGGG + Intergenic
951561175 3:23968106-23968128 AAAGTTATATAGAGGGAATAAGG + Intronic
952326406 3:32324343-32324365 CAAGTTATTCCCAGAGAAAAAGG + Intronic
952625356 3:35396298-35396320 CAGGTTATGGAAAGGGAAGAGGG + Intergenic
955221642 3:57027935-57027957 CCAGTGATGATGAGGGAAAAAGG - Intronic
956515071 3:70037506-70037528 CAAGAGATGGAGAGAGAAAAAGG + Intergenic
957440206 3:80236545-80236567 CAGGTTTTGGAGATGGAAAAGGG - Intergenic
957797251 3:85026710-85026732 GAAGTTACCCAGAGGGAAACTGG + Intronic
959486993 3:106938385-106938407 AAAGTTTTGCAGTAGGAAAAAGG + Intergenic
960329498 3:116341119-116341141 CAAGTAATGCATAGATAAAATGG + Intronic
961026105 3:123559332-123559354 AAATTTATCTAGAGGGAAAAAGG + Intronic
962636998 3:137341360-137341382 CAGGGGATGCAGGGGGAAAAAGG - Intergenic
963254159 3:143128207-143128229 GAAGTTATTCAGAGGAAAATGGG - Intergenic
965084505 3:164077476-164077498 CAGGGAAAGCAGAGGGAAAAAGG + Intergenic
966438815 3:179920474-179920496 TATGTTATGAAGTGGGAAAAGGG + Intronic
966750306 3:183315705-183315727 AGAGTTCTGCAGAGGTAAAAAGG - Intronic
970939310 4:21612986-21613008 AAAGGTATGTAGAGAGAAAAAGG + Intronic
973560741 4:52132885-52132907 CAAGTTATACATGGGGAAACTGG - Intergenic
974163387 4:58169113-58169135 CAAGTGTTACAGAGGGGAAAAGG - Intergenic
975124054 4:70761895-70761917 CAAATTATGCAGAGAAAAGAGGG + Intronic
976900948 4:90175223-90175245 CTAGTTATGCTGAGTGAAAGGGG + Intronic
979281060 4:118868743-118868765 CAAGTTAGAAAGAAGGAAAATGG + Intronic
980290232 4:130840600-130840622 CAAGTTATCCAGTGAGGAAAAGG + Intergenic
981002191 4:139838677-139838699 CAAGTTTTCCATAGGAAAAATGG + Intronic
981529431 4:145737353-145737375 CATATTATGCAAAGGCAAAATGG + Intronic
982289364 4:153764343-153764365 CCAGTTAGGCAGAGGGACCAAGG - Intergenic
982513889 4:156319781-156319803 CATGTTATGAAGAGTGGAAATGG - Intergenic
982862323 4:160468473-160468495 CAATTTAAGCAGAAGGCAAAGGG + Intergenic
984592996 4:181637170-181637192 CTAATTTTGCAGAGGAAAAAAGG - Intergenic
988342843 5:29997299-29997321 TAATTTATTCTGAGGGAAAATGG - Intergenic
988985697 5:36616398-36616420 TAAGTTATACAAAGGGAAAAAGG - Intronic
990925852 5:61021720-61021742 CATGGTATGCAAAGGTAAAAAGG - Intronic
993255999 5:85590847-85590869 CCACTTATTTAGAGGGAAAATGG + Intergenic
994608477 5:102003588-102003610 CAATATATGCACAGGGTAAATGG + Intergenic
995460825 5:112400921-112400943 AAAGTTATCCAGAAGGAATAGGG - Intronic
995649538 5:114354419-114354441 CAAATCATTCAGAGGGAAGAAGG - Intergenic
996229990 5:121051312-121051334 CAAATTAAGCAGAGGCAATAGGG - Intergenic
996289608 5:121836271-121836293 CACTTTATACAGAGGGAAAAAGG + Intergenic
996980193 5:129482326-129482348 CAAGGTATACAGAAGAAAAAAGG + Intronic
997110742 5:131071328-131071350 CAAACTTTGCAGAGGTAAAAAGG - Intergenic
999174451 5:149622027-149622049 CAAGTGCTGCAGAGGGCAGAGGG + Exonic
1001278994 5:170372453-170372475 CAACCTCTGCAGAGGGAAGAGGG - Intronic
1001909540 5:175504081-175504103 CAAGAGAGGCAGAGAGAAAAAGG + Intronic
1003215814 6:4110151-4110173 CAAGTGAAACAGAGAGAAAAAGG - Intronic
1005034980 6:21547273-21547295 CAAGATAGCCAGATGGAAAAGGG + Intergenic
1006267859 6:32940386-32940408 CAAATTATTGAGAGAGAAAAAGG + Intronic
1009223412 6:61003143-61003165 CATAATATGCAGAGGGAAAGAGG + Intergenic
1010301430 6:74264723-74264745 CGATTGAGGCAGAGGGAAAAAGG + Intergenic
1010445625 6:75945660-75945682 CAATTTCTGCAAATGGAAAATGG - Intronic
1011132282 6:84064089-84064111 GAAGTTATGGACAGGGAAGAGGG + Intronic
1011503551 6:88016849-88016871 TCAGCTATGCAGAGGCAAAATGG + Intergenic
1011818567 6:91223109-91223131 CAAGTGATGCAACGGGATAATGG + Intergenic
1011909162 6:92413321-92413343 CAAGTTATGCAGATGGATGGTGG + Intergenic
1013075438 6:106766667-106766689 AAAGTGAAGCAGAGGTAAAATGG - Intergenic
1013288743 6:108701895-108701917 CAGGGAATGCAGAGGCAAAAAGG - Intergenic
1014886229 6:126784791-126784813 CATTTTATCCAGTGGGAAAAAGG + Intergenic
1015201604 6:130587714-130587736 CGATATATGCAGAGGTAAAAAGG + Intergenic
1016130346 6:140460656-140460678 CAAGTTTTGAAGAGAGAAAGGGG - Intergenic
1016872352 6:148830861-148830883 AAAGTTATGGAGAGGGATAGTGG + Intronic
1017333808 6:153231035-153231057 AAAATGATGCAGAGGGTAAAAGG + Intergenic
1017718024 6:157225513-157225535 CGATTTAGGCATAGGGAAAAGGG + Intergenic
1017846662 6:158264476-158264498 CATTTTCTGGAGAGGGAAAATGG - Intronic
1017880187 6:158557443-158557465 CATGTTATGAAAAGGGGAAAGGG - Intronic
1018668352 6:166160229-166160251 CAAGTTATGCAGAGGGAAAAAGG - Intronic
1019087076 6:169488657-169488679 AAAGTTAGGAAAAGGGAAAATGG - Intronic
1020069705 7:5218464-5218486 AATGTCATGCAGAGTGAAAAAGG - Intronic
1020808273 7:12818329-12818351 CAAATTATGGGGAGGGAAGAAGG - Intergenic
1021108612 7:16668320-16668342 CAAGTGATTCAGAGGCAAACCGG - Intronic
1021340309 7:19456224-19456246 AAAGTTAGCAAGAGGGAAAATGG - Intergenic
1022454803 7:30549027-30549049 ATAGTAATGCAGAGGGAGAAAGG - Intronic
1023585232 7:41723133-41723155 CAAAGTATGCAGACTGAAAAGGG - Intergenic
1023711944 7:43004227-43004249 AAAGTTATGCAGATGGATAGTGG - Intergenic
1024002189 7:45197517-45197539 CAAGGTTTGCAGTGGGAGAAAGG + Intergenic
1025110590 7:56212932-56212954 CCATTTATGCATAGGGAAACTGG - Intergenic
1026241431 7:68578897-68578919 CAAGTTCTCCAGAGGGACAATGG + Intergenic
1027687937 7:81301266-81301288 CAAGTAAAGCAGAAGTAAAAAGG + Intergenic
1027689820 7:81330386-81330408 CAAGGGATCCAGAAGGAAAAAGG - Intergenic
1030105896 7:105987070-105987092 CAAATTATGCAGACAGAATAAGG + Intronic
1030113866 7:106048788-106048810 CTTGTTATGCAGATGAAAAAAGG + Intergenic
1030407230 7:109129726-109129748 TAAGATCTGCAGAGGCAAAAGGG - Intergenic
1030460025 7:109822775-109822797 CAAGTTATTCAGTGATAAAAAGG - Intergenic
1030869590 7:114738637-114738659 AAATTTATGCACAGGGAAAAAGG - Intergenic
1031453993 7:121957149-121957171 GAAGGTACCCAGAGGGAAAAAGG - Intronic
1031460964 7:122047984-122048006 TAATAGATGCAGAGGGAAAAGGG + Intronic
1031865481 7:127034535-127034557 CTGGATATGAAGAGGGAAAAGGG - Intronic
1032014006 7:128364797-128364819 CAAGTTATACAAAGAGAAGAGGG + Intergenic
1033840435 7:145367004-145367026 AAAGTTTTGGAAAGGGAAAATGG - Intergenic
1034973349 7:155433116-155433138 CTAGTGTTGCAGTGGGAAAATGG + Intergenic
1036135971 8:6162026-6162048 CAAGGTTTGCAGTGGGAGAAAGG + Intergenic
1036207793 8:6818040-6818062 CAAGTTGTGCAGAGGTGACAGGG - Intronic
1036229727 8:6989666-6989688 CAAGGTAGGCAGAGTGAAGAGGG + Intergenic
1036232178 8:7008769-7008791 CAAGGTAGGCAGAGTGAAGAGGG + Intronic
1036472870 8:9066263-9066285 CAAGTTGTGCAGGTGGAGAAAGG - Intronic
1038277504 8:26134241-26134263 CAAGCCATGCAGAGGGGAGAAGG - Intergenic
1040881496 8:52210029-52210051 CAAGTCATTCAGAGAAAAAAAGG - Intronic
1042110468 8:65376105-65376127 GAAGTGAAGAAGAGGGAAAAAGG - Intergenic
1042390788 8:68231121-68231143 CAAGCTATGCAGAGGGGCACTGG + Intronic
1042452410 8:68963241-68963263 CAATTCATGCAGAAGGGAAATGG + Intergenic
1043737089 8:83762007-83762029 CAAGCTATGGTGGGGGAAAAAGG + Intergenic
1043784534 8:84381343-84381365 CAAGTTATCCACATGGGAAATGG - Intronic
1043815345 8:84794193-84794215 TAAGTTGTGCAGAGTGTAAATGG - Intronic
1044603508 8:94028893-94028915 TAATGTATGCAGAAGGAAAATGG + Intergenic
1044910555 8:97053995-97054017 GGAGTTAGGCAGGGGGAAAAGGG + Intronic
1046491519 8:114958496-114958518 CAAGTTATATAAAGGAAAAATGG + Intergenic
1048058864 8:130896639-130896661 TAAGTTATGCTTAGAGAAAAGGG + Intronic
1053047553 9:34932362-34932384 GAGGTTCTGCAGAGGGCAAATGG + Intergenic
1055650377 9:78401122-78401144 AAGGTTTTGCAGAGAGAAAAAGG - Intergenic
1055964040 9:81847845-81847867 AAAAGTAAGCAGAGGGAAAAAGG + Intergenic
1056268369 9:84922562-84922584 AAAGTTATGCAGCTGGAAAGTGG - Intronic
1056361383 9:85861138-85861160 GAAGTTACGAAGAGGGAAGAAGG + Intergenic
1057966950 9:99513477-99513499 AAAGTTATACAGATGGAAAATGG + Intergenic
1058804351 9:108576848-108576870 CAAGTGCTGCAGAGGGAAGGTGG - Intergenic
1059974495 9:119701114-119701136 AGAGTTATGAACAGGGAAAAGGG + Intergenic
1060304167 9:122395239-122395261 AAAGTTTTGCAAAGGGAAACAGG + Exonic
1060890673 9:127186283-127186305 AAAATTATGCTGAGGAAAAATGG + Intronic
1061334058 9:129917761-129917783 AAACTTTTGCAGGGGGAAAATGG + Intronic
1061765643 9:132879346-132879368 TACCTTATGGAGAGGGAAAATGG + Intronic
1186055374 X:5644128-5644150 AAAGTTTTGCAGTGGGAGAAGGG + Intergenic
1186075541 X:5874555-5874577 AAAGCTATGCAGAGAGAAGAAGG - Intronic
1186971145 X:14844963-14844985 CAAATTATGGAGAGAGAAAGTGG - Exonic
1187598188 X:20798067-20798089 CAAGTGATGCTCAGGGAAAAGGG - Intergenic
1187709716 X:22040991-22041013 CAAGAGATGGAGAGGGAGAATGG + Intronic
1187723505 X:22176790-22176812 AAAATTATGCAGAGTGAATAAGG - Intronic
1188812590 X:34669798-34669820 TATGTTATACAGAGGGAACAAGG + Intergenic
1190337165 X:49269714-49269736 CAAGTATTGCAGAGGGCCAATGG - Intergenic
1194007761 X:88518224-88518246 CAAGTGTTCCAGAGGCAAAAAGG + Intergenic
1195020907 X:100826986-100827008 CAAGTTAACAAGGGGGAAAATGG + Intronic
1196635142 X:117993664-117993686 CAAGTTACTGAGAGAGAAAAAGG + Intronic
1198452744 X:136784111-136784133 GAAGATCTGCAGTGGGAAAAAGG + Intergenic
1198477562 X:137010028-137010050 CAATTTTTGAATAGGGAAAATGG - Intergenic
1199427353 X:147718269-147718291 GAAGAGATGCTGAGGGAAAAGGG + Intergenic
1199808872 X:151329237-151329259 CAAGTTCTGCAGAGGGATGGTGG + Intergenic
1199858627 X:151780233-151780255 AAAGTTAAGCAGAGACAAAAGGG - Intergenic