ID: 1018670521

View in Genome Browser
Species Human (GRCh38)
Location 6:166173172-166173194
Sequence TTGGCCCTGAATAAAATATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018670517_1018670521 10 Left 1018670517 6:166173139-166173161 CCTCCTCTACAACTAATTTTGAA No data
Right 1018670521 6:166173172-166173194 TTGGCCCTGAATAAAATATCTGG No data
1018670518_1018670521 7 Left 1018670518 6:166173142-166173164 CCTCTACAACTAATTTTGAAAAA No data
Right 1018670521 6:166173172-166173194 TTGGCCCTGAATAAAATATCTGG No data
1018670516_1018670521 11 Left 1018670516 6:166173138-166173160 CCCTCCTCTACAACTAATTTTGA No data
Right 1018670521 6:166173172-166173194 TTGGCCCTGAATAAAATATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018670521 Original CRISPR TTGGCCCTGAATAAAATATC TGG Intergenic
No off target data available for this crispr