ID: 1018673879

View in Genome Browser
Species Human (GRCh38)
Location 6:166202379-166202401
Sequence CACGCCTCACAGCTGGGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018673879_1018673890 24 Left 1018673879 6:166202379-166202401 CCCAGTCCCAGCTGTGAGGCGTG No data
Right 1018673890 6:166202426-166202448 TGGCCCCATTGCTTCCCTAGCGG No data
1018673879_1018673884 -1 Left 1018673879 6:166202379-166202401 CCCAGTCCCAGCTGTGAGGCGTG No data
Right 1018673884 6:166202401-166202423 GGCTCCCAGTCCCAGCTGTGAGG No data
1018673879_1018673891 25 Left 1018673879 6:166202379-166202401 CCCAGTCCCAGCTGTGAGGCGTG No data
Right 1018673891 6:166202427-166202449 GGCCCCATTGCTTCCCTAGCGGG No data
1018673879_1018673887 4 Left 1018673879 6:166202379-166202401 CCCAGTCCCAGCTGTGAGGCGTG No data
Right 1018673887 6:166202406-166202428 CCAGTCCCAGCTGTGAGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018673879 Original CRISPR CACGCCTCACAGCTGGGACT GGG (reversed) Intergenic
No off target data available for this crispr