ID: 1018674040

View in Genome Browser
Species Human (GRCh38)
Location 6:166203528-166203550
Sequence CCATCTGATGTTACCACAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018674035_1018674040 -3 Left 1018674035 6:166203508-166203530 CCCTGGCCTGGGCCACTCTTCCA No data
Right 1018674040 6:166203528-166203550 CCATCTGATGTTACCACAGTTGG No data
1018674030_1018674040 22 Left 1018674030 6:166203483-166203505 CCACCTGAGGTTTTGCACAGGGT No data
Right 1018674040 6:166203528-166203550 CCATCTGATGTTACCACAGTTGG No data
1018674037_1018674040 -9 Left 1018674037 6:166203514-166203536 CCTGGGCCACTCTTCCATCTGAT No data
Right 1018674040 6:166203528-166203550 CCATCTGATGTTACCACAGTTGG No data
1018674036_1018674040 -4 Left 1018674036 6:166203509-166203531 CCTGGCCTGGGCCACTCTTCCAT No data
Right 1018674040 6:166203528-166203550 CCATCTGATGTTACCACAGTTGG No data
1018674028_1018674040 23 Left 1018674028 6:166203482-166203504 CCCACCTGAGGTTTTGCACAGGG No data
Right 1018674040 6:166203528-166203550 CCATCTGATGTTACCACAGTTGG No data
1018674031_1018674040 19 Left 1018674031 6:166203486-166203508 CCTGAGGTTTTGCACAGGGTCTC No data
Right 1018674040 6:166203528-166203550 CCATCTGATGTTACCACAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018674040 Original CRISPR CCATCTGATGTTACCACAGT TGG Intergenic
No off target data available for this crispr