ID: 1018677588

View in Genome Browser
Species Human (GRCh38)
Location 6:166236275-166236297
Sequence ATGCAGTTTCTGAATGACGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018677588_1018677589 9 Left 1018677588 6:166236275-166236297 CCTTCGTCATTCAGAAACTGCAT No data
Right 1018677589 6:166236307-166236329 TAAAATGAAAAGCATTGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018677588 Original CRISPR ATGCAGTTTCTGAATGACGA AGG (reversed) Intergenic
No off target data available for this crispr