ID: 1018681930

View in Genome Browser
Species Human (GRCh38)
Location 6:166271760-166271782
Sequence CCATCAAGGATAGCAGCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018681923_1018681930 0 Left 1018681923 6:166271737-166271759 CCCTACTCAGGCATGGGCCCCAT No data
Right 1018681930 6:166271760-166271782 CCATCAAGGATAGCAGCTACTGG No data
1018681918_1018681930 24 Left 1018681918 6:166271713-166271735 CCCTCTGGCGTTTTAGGGGCATC No data
Right 1018681930 6:166271760-166271782 CCATCAAGGATAGCAGCTACTGG No data
1018681924_1018681930 -1 Left 1018681924 6:166271738-166271760 CCTACTCAGGCATGGGCCCCATC No data
Right 1018681930 6:166271760-166271782 CCATCAAGGATAGCAGCTACTGG No data
1018681915_1018681930 29 Left 1018681915 6:166271708-166271730 CCAGACCCTCTGGCGTTTTAGGG No data
Right 1018681930 6:166271760-166271782 CCATCAAGGATAGCAGCTACTGG No data
1018681919_1018681930 23 Left 1018681919 6:166271714-166271736 CCTCTGGCGTTTTAGGGGCATCT No data
Right 1018681930 6:166271760-166271782 CCATCAAGGATAGCAGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018681930 Original CRISPR CCATCAAGGATAGCAGCTAC TGG Intergenic
No off target data available for this crispr