ID: 1018686128

View in Genome Browser
Species Human (GRCh38)
Location 6:166306748-166306770
Sequence CAGGTGGGTGGCCGCGACGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 153}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018686128_1018686138 4 Left 1018686128 6:166306748-166306770 CCACCGTCGCGGCCACCCACCTG 0: 1
1: 0
2: 0
3: 15
4: 153
Right 1018686138 6:166306775-166306797 ATCGCCCACCGCACTGTCCAGGG 0: 1
1: 0
2: 1
3: 3
4: 67
1018686128_1018686137 3 Left 1018686128 6:166306748-166306770 CCACCGTCGCGGCCACCCACCTG 0: 1
1: 0
2: 0
3: 15
4: 153
Right 1018686137 6:166306774-166306796 CATCGCCCACCGCACTGTCCAGG 0: 1
1: 0
2: 0
3: 9
4: 80
1018686128_1018686143 17 Left 1018686128 6:166306748-166306770 CCACCGTCGCGGCCACCCACCTG 0: 1
1: 0
2: 0
3: 15
4: 153
Right 1018686143 6:166306788-166306810 CTGTCCAGGGTGCCCGGCGCCGG 0: 1
1: 0
2: 0
3: 16
4: 189
1018686128_1018686146 24 Left 1018686128 6:166306748-166306770 CCACCGTCGCGGCCACCCACCTG 0: 1
1: 0
2: 0
3: 15
4: 153
Right 1018686146 6:166306795-166306817 GGGTGCCCGGCGCCGGCTGAGGG 0: 1
1: 0
2: 0
3: 12
4: 152
1018686128_1018686145 23 Left 1018686128 6:166306748-166306770 CCACCGTCGCGGCCACCCACCTG 0: 1
1: 0
2: 0
3: 15
4: 153
Right 1018686145 6:166306794-166306816 AGGGTGCCCGGCGCCGGCTGAGG 0: 1
1: 0
2: 1
3: 20
4: 214
1018686128_1018686141 11 Left 1018686128 6:166306748-166306770 CCACCGTCGCGGCCACCCACCTG 0: 1
1: 0
2: 0
3: 15
4: 153
Right 1018686141 6:166306782-166306804 ACCGCACTGTCCAGGGTGCCCGG 0: 1
1: 0
2: 1
3: 10
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018686128 Original CRISPR CAGGTGGGTGGCCGCGACGG TGG (reversed) Exonic
900152190 1:1183545-1183567 CAGGTGGAGGGACGCGAGGGAGG - Intronic
901000494 1:6146645-6146667 CAGGTGAGTGCCCGGGAGGGTGG - Exonic
902550930 1:17219221-17219243 CAAGGGGGTGGCCGCAGCGGGGG + Intronic
903069098 1:20717822-20717844 CAGGGGCGGGGCCGCGGCGGGGG + Exonic
904029020 1:27522496-27522518 CAGGGCGGTGGCGGCGGCGGTGG + Intergenic
904249555 1:29213314-29213336 CAGGTGGGTGTAGGAGACGGTGG + Intronic
906079395 1:43074385-43074407 CAGGTGGATGGCGGGGTCGGGGG - Intergenic
906301252 1:44683349-44683371 CAGGTGGGAGGCCCAGACTGAGG + Intronic
915493680 1:156266237-156266259 TGGGTGGGTGGCGGCGACGGCGG + Exonic
915978697 1:160407228-160407250 TAGGGGGGTGGTCGCGATGGTGG + Intronic
916061100 1:161098971-161098993 CAGGTGGCTGGCCGGGAGGGCGG + Exonic
917906605 1:179591844-179591866 CAGGAAGGTAGCTGCGACGGCGG - Exonic
920021927 1:202962869-202962891 CAGGTGGGTGACAGGGATGGCGG - Intronic
920501920 1:206490879-206490901 CAGGTGGGTGGGCAGGAGGGTGG + Intronic
923715950 1:236425034-236425056 GAGGTGGCTGCCTGCGACGGGGG - Intronic
1067101330 10:43336811-43336833 CAGGTGGCTGGCCCTGAGGGTGG + Intergenic
1067377117 10:45737824-45737846 CAGGTGGGTGTCCGTAACAGTGG - Intronic
1067884823 10:50078516-50078538 CAGGTGGGTGTCCGTAACAGTGG - Intronic
1071566370 10:86673375-86673397 CAGGTGGGAGGCAGCGGCAGTGG + Intronic
1072731574 10:97850212-97850234 CAGGTGGGCGGCGGCGGTGGCGG - Intergenic
1074530755 10:114297238-114297260 CAGGTGGGTGGTGTCCACGGTGG + Exonic
1076188734 10:128468278-128468300 CAGGAGGGTGGACTCGACGTCGG + Intergenic
1076890590 10:133281253-133281275 CAGGTGGGTGGGCGCCACCCCGG - Exonic
1077134543 11:991935-991957 CATGTGGGTGGCTGCCACGTGGG + Intronic
1077247400 11:1546392-1546414 AGGGGGGGTGGCCGCGAAGGGGG + Intergenic
1079296726 11:19241328-19241350 CGGGAGGGTGGCGGCGGCGGCGG - Intronic
1079838452 11:25365054-25365076 CATGAGGGTGGCCGGGAGGGAGG - Intergenic
1083144668 11:60749345-60749367 CAGATGGGTGGCTGTGAGGGTGG - Intergenic
1083721943 11:64607655-64607677 CAGGTTGGGGGCCGGGGCGGAGG + Exonic
1083871089 11:65489019-65489041 CAGGAGAGTGGCCACGACTGTGG + Intergenic
1084171934 11:67405079-67405101 CAGGTGGGTGGCCCGGCCTGGGG - Exonic
1084179083 11:67437633-67437655 GAGGTGGGTGCCCGGCACGGAGG - Exonic
1084385416 11:68840770-68840792 CTGTTGGCTGGCCGCGGCGGTGG + Intronic
1089768634 11:120786522-120786544 CAGGTGGGTGGGCAGGACTGGGG - Intronic
1090635806 11:128689871-128689893 TACGTGGGAGGCCGCGGCGGCGG - Intronic
1091695740 12:2627050-2627072 CAGGCGGGTGGAGGCGAGGGGGG - Intronic
1096548380 12:52356579-52356601 CCGGTGGCTGGACGTGACGGTGG + Intergenic
1099413379 12:82358914-82358936 CAGGTGCGTGGCGGCGGAGGCGG + Intronic
1104883024 12:132084934-132084956 CAGGCGGGCGGCAGTGACGGGGG - Intronic
1104939851 12:132389998-132390020 CAGGTGGGGGGCGGGGGCGGGGG - Intergenic
1104944581 12:132409921-132409943 CAGGTGTGTGGCGGTTACGGAGG - Intergenic
1104954645 12:132458122-132458144 CAGGTGGGTGGACGGGTGGGTGG + Intergenic
1108747502 13:53409850-53409872 CAGGTGGGTGGCCAGGAGGTGGG - Intergenic
1113878202 13:113607749-113607771 CCAGTGGGTGGCGGTGACGGGGG + Intronic
1113953116 13:114082752-114082774 CAGGTGGGTGGTCCCAACAGAGG + Intronic
1113977002 13:114235130-114235152 CAGGTGGGCGGCCCCGACTCGGG + Exonic
1117156953 14:52951057-52951079 CAGGCGAGGGGCCGCGACGACGG - Intronic
1119547201 14:75480470-75480492 CAGGTGGGTGGGAGGGTCGGTGG + Intergenic
1119655327 14:76413327-76413349 CAGGTGTGTGGCCGGGGCCGGGG - Intronic
1120210426 14:81628641-81628663 GAGGTGGGTGGCCATGAGGGAGG - Intergenic
1121442580 14:93958157-93958179 CAGGTGGGAGGGCGTGACAGCGG - Intronic
1129597340 15:76975143-76975165 CAGGAGGGTGGCAGGGAGGGGGG - Intergenic
1131385273 15:92001201-92001223 CAGGTGGGTGGGCGGGGGGGAGG + Intronic
1131859487 15:96637246-96637268 CAGGTGGGTGGGGGCGGTGGCGG + Intergenic
1135466117 16:22686447-22686469 CAGGTGGGTGGCTGAGTGGGTGG - Intergenic
1136567866 16:31080709-31080731 CAGGTGGGTGGCCGGTAGGTGGG + Exonic
1136913014 16:34159610-34159632 CCGGGGGCTGGCCGCGATGGCGG + Intergenic
1137988647 16:53131072-53131094 GCGGTGGGTGGCAGCGGCGGCGG - Intronic
1139406686 16:66724679-66724701 CAGGTGGGTGGCTGCCACAGAGG + Intronic
1141989665 16:87602718-87602740 CAGGTGGGGGGCCGCGGCCCGGG + Intronic
1143090326 17:4446106-4446128 CAGGACGGTGGGCGCGATGGTGG - Exonic
1143244092 17:5468551-5468573 TCGGTGAGTGGCCGCGCCGGCGG - Exonic
1144645725 17:16972214-16972236 CAGGTGGGTGGCTGCGGCCCAGG + Intergenic
1145203728 17:20969367-20969389 CAGGTGGGTGGCCGCGGCCCAGG - Intergenic
1145905681 17:28514876-28514898 AAGGTGGGTGGGGGCGACGTTGG - Intronic
1147015653 17:37489776-37489798 GAGGTGGGGGGACGCGACGCGGG - Intergenic
1147176202 17:38657713-38657735 CAGGAGGCTGGCCGGGAGGGAGG + Intergenic
1147753644 17:42753797-42753819 CATGGTGGTGGCAGCGACGGTGG + Intergenic
1147882409 17:43662699-43662721 CAGGTGGGTGGAGGTGAAGGGGG - Intergenic
1148906200 17:50913920-50913942 TAGGTGTGAGGCCGGGACGGTGG - Intergenic
1151472178 17:74325408-74325430 CAGGTGGCTGGCCGAGTTGGAGG + Intergenic
1151477494 17:74352338-74352360 CAGGTGGGTGGGCGCCTGGGCGG + Exonic
1152191822 17:78892767-78892789 CAGCTGGGTGGAGGCGAGGGAGG + Intronic
1152214490 17:79024492-79024514 GAGGTAGGTGGCCGGGCCGGGGG + Exonic
1152519054 17:80844886-80844908 AAGGTGGGTGGCCGCAGTGGAGG - Intronic
1155799354 18:30081633-30081655 CAGGTGGGTGCCAGCTATGGTGG + Intergenic
1161575317 19:5051627-5051649 CAGGTGCGTGGCAGCCACAGAGG + Intronic
1161720110 19:5897752-5897774 CAGGTAGGTGGTGGGGACGGAGG + Intronic
1161723271 19:5915144-5915166 CAGGTGGGTGGCTGCGCGGGGGG + Exonic
1163014161 19:14443500-14443522 CAGGTTGGTGGCCGAGCAGGTGG - Exonic
1165432781 19:35781928-35781950 CAGGGGGGTGGCCAAGAGGGAGG + Intronic
1165760695 19:38319790-38319812 GAGGTGGGGGGCGGCGACGGAGG - Intergenic
1166165379 19:40984173-40984195 CAGGTGGGTGCCAGCCATGGTGG - Intergenic
1166679474 19:44758152-44758174 CGGGTGGGTGGCCGGCACGTGGG - Intronic
1166883008 19:45940361-45940383 CAGGAGGTTGGCGGCGGCGGCGG + Exonic
1167299436 19:48670573-48670595 GAGGTGGCTGGCCGCCACAGTGG + Exonic
1167557472 19:50205305-50205327 CAGGTGGGCGGCGGCGGCGGCGG - Intronic
1167593278 19:50415668-50415690 CAGGTGGGTGGCGGGGGTGGGGG - Intronic
1167601458 19:50457429-50457451 CAGGTGGGTGTCTGGGAAGGCGG - Intronic
1167603716 19:50468952-50468974 CAGGTGGCTGGACGCAAGGGTGG - Intronic
1168297384 19:55384057-55384079 CAGGTGCGCGGCCGCGACTTCGG - Exonic
925184702 2:1839129-1839151 CAGGTGAGTGGCCGCGTCTGCGG - Exonic
925360447 2:3277178-3277200 CAGGTGTGGGGCCGCGTGGGTGG - Intronic
925360463 2:3277230-3277252 CAGGTGTGGGGCCGCGTGGGTGG - Intronic
925360471 2:3277256-3277278 CAGGTGTGGGGCCGCGTGGGTGG - Intronic
925714324 2:6771006-6771028 CAGGTGGATGGCTGCGCCGGGGG - Intergenic
930517340 2:52424511-52424533 CAGGAGGGAGGCAGCGAGGGAGG + Intergenic
931730826 2:65151896-65151918 CAGGTGGGTGGCGGGGGCAGGGG + Intergenic
933206345 2:79512711-79512733 CAGGTGGGGGGAGGGGACGGCGG - Intronic
935204240 2:100883825-100883847 CAGGTAGGTGGCCTCGGGGGAGG - Intronic
937277942 2:120697854-120697876 CAGATGGATGGTGGCGACGGTGG + Intergenic
938537192 2:132256633-132256655 CAGGGGGCTGGCCGCGACAGTGG - Intronic
941906051 2:170716709-170716731 CAGGTGGGCGGCGGGGGCGGTGG - Exonic
942278055 2:174336804-174336826 CAGGTGGGAGGCGGCGGCGGCGG - Exonic
943754522 2:191544125-191544147 CGGGTGGGTGGATGCGACTGAGG - Intergenic
946391799 2:219420654-219420676 AAGGTGGGTGGCCTCGCCCGGGG + Exonic
948910262 2:240999130-240999152 CAAGTGGCTGGCGGCGGCGGCGG - Intronic
949012068 2:241686634-241686656 CGGGTGGGTGCGCGCGGCGGGGG - Exonic
1169129701 20:3159746-3159768 CAGGTGAGTGGCGGCGGCCGGGG - Exonic
1171866095 20:30488412-30488434 CCGGGGGCTGGCCGCGACAGTGG - Intergenic
1172587287 20:36093512-36093534 GCGGTGGGTGGCGGCGGCGGGGG + Intronic
1173807421 20:45934949-45934971 CGGGTGGGCGGCCGCGCCGGTGG + Intronic
1175583800 20:60121428-60121450 CTGGTGGGGGACCGGGACGGTGG + Intergenic
1176591650 21:8654973-8654995 CAGGTGGATGGCAGTGACGGAGG + Intergenic
1178414625 21:32393499-32393521 CTGGTGGCTGGCCGGGAAGGTGG + Exonic
1180274498 22:10632085-10632107 CAGGTGGATGGCAGTGACGGAGG + Intergenic
1180312809 22:11253286-11253308 CAGGGGGCTGGCCTCGACAGTGG - Intergenic
1180342436 22:11629086-11629108 CTGGGGGCTGGCCGCGATGGCGG + Intergenic
1180650070 22:17369907-17369929 GAGGTGAGTGGCCGCGCGGGCGG + Exonic
1181988200 22:26816444-26816466 CAAGTGGGTGGCCGTGGAGGGGG + Intergenic
1183608699 22:38882910-38882932 CAGATGGGTGCCCAAGACGGAGG + Intergenic
950200354 3:11037933-11037955 GGGGTGGGTGGCAGCGAGGGTGG - Exonic
951908012 3:27722410-27722432 CAGGTGGGTAGCCCCGGCGCGGG - Intronic
952889264 3:38029859-38029881 CCCGTGGGTGGCGGCGGCGGAGG - Intergenic
954540856 3:51392199-51392221 CAGGGGCGGGGCAGCGACGGGGG - Exonic
956678336 3:71754945-71754967 CAGGTAGCTGGCCACGACGTAGG - Exonic
960120918 3:113948014-113948036 CAGGTGGGCGGCTGCGGCGAGGG + Exonic
965540388 3:169865821-169865843 CAGGTGGGTGGACATGAGGGAGG + Intronic
967930430 3:194686784-194686806 CAGCTGGGCGGCGGCGGCGGCGG - Exonic
980994194 4:139764869-139764891 CAGGAGTGTGGCCGCGATGCCGG - Intronic
982157332 4:152535564-152535586 CGGGCGGGTGGCCGAGTCGGCGG + Exonic
983583780 4:169334862-169334884 CAGGTGGGTGGCAGGGTCTGTGG + Intergenic
985685079 5:1277650-1277672 CAGGTGGGCGGTGGGGACGGGGG + Intronic
985782463 5:1878374-1878396 CAGGGAGGTGGCGGCGGCGGCGG + Exonic
989338650 5:40349064-40349086 CAGGTGGGTGGCAGCTGAGGTGG - Intergenic
999956590 5:156709836-156709858 CGGGAGGGTGGCGGCGTCGGGGG - Intronic
1002926019 6:1606104-1606126 CATCTGGGTGGCCGCGACCTTGG - Intergenic
1006122617 6:31816418-31816440 CAGGTGGGTGTCCCCGGCCGTGG - Exonic
1006124480 6:31828612-31828634 CAGGTGGGTGTCCCCGGCCGTGG - Exonic
1006392129 6:33764574-33764596 CAGGTCTGTGGCCCCGACGGTGG + Intergenic
1007046815 6:38783945-38783967 CAGGTGGGTTGCTGGAACGGTGG + Intronic
1007095000 6:39207634-39207656 CAGGTGGGTGGCGGGGGTGGGGG + Intronic
1007751095 6:44072609-44072631 CAAGTGGGTGGCCGGGGGGGGGG - Intergenic
1017672024 6:156777852-156777874 CTGGGGGGCGGCGGCGACGGCGG + Intergenic
1018686128 6:166306748-166306770 CAGGTGGGTGGCCGCGACGGTGG - Exonic
1023232751 7:38051404-38051426 CAGGTGGGTGCCAGCTATGGTGG + Intergenic
1028520148 7:91721074-91721096 CAGGTGGGTGCCAGCAATGGTGG - Intronic
1029667905 7:102007702-102007724 GAGGTGGGTGGTGGCGAGGGAGG - Intronic
1032020843 7:128406333-128406355 AAGGTGGGTGGCCCCGGCTGGGG - Intronic
1033654408 7:143362920-143362942 GAGGAGGGGGGCGGCGACGGCGG - Intergenic
1034430789 7:151040299-151040321 CAGGTGAGTGGCCGGTAGGGTGG + Exonic
1035315184 7:157993086-157993108 CAGGTGGGTGGCCTCTATTGAGG + Intronic
1035602142 8:902937-902959 CAGGTGGGTGGGGGCGGGGGCGG + Intergenic
1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG + Exonic
1039621042 8:38997158-38997180 CAGGTGGGTGTCCGCGCCCCGGG + Exonic
1039779441 8:40770014-40770036 GAGGTGGGGGGCCCCGAGGGAGG - Intronic
1041040741 8:53843458-53843480 CAGGTGGGAGGCGGCGAGCGTGG + Intronic
1045295986 8:100872067-100872089 CAGGTGGGTGGCTTCGACCTGGG + Intergenic
1049177910 8:141205737-141205759 GTGGTGGGCGGCCGTGACGGCGG - Intergenic
1049528949 8:143143745-143143767 CAGGTGGGTGGGCGGGCAGGCGG + Intergenic
1049773124 8:144392890-144392912 CAGGTGAGTGGCCGCGGGGCAGG + Exonic
1049776689 8:144409269-144409291 CAGGTGGGCGGCCGGGCGGGCGG - Exonic
1049847058 8:144807937-144807959 CAGGAGGGTGCCCAGGACGGCGG + Exonic
1061008442 9:127941726-127941748 CAGCTGGGGGGCCGGGATGGGGG - Exonic
1203768160 EBV:37176-37198 CAGATGGGTGGCCACCATGGTGG - Intergenic
1199265000 X:145818623-145818645 CTGATGGGCGGCCGGGACGGAGG + Exonic
1200236161 X:154468736-154468758 CAGGTGGGTGGGCGGCAGGGAGG + Intronic
1200247066 X:154531957-154531979 AAGGAGGGTGGCCGTGGCGGGGG + Exonic
1201077150 Y:10196795-10196817 CCGGGGGCTGGCCGTGACGGCGG + Intergenic