ID: 1018686358

View in Genome Browser
Species Human (GRCh38)
Location 6:166307579-166307601
Sequence CTAGGGCCGCGGGCCCGCGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 154}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018686358_1018686365 -9 Left 1018686358 6:166307579-166307601 CCTCCGCGGGCCCGCGGCCCTAG 0: 1
1: 0
2: 1
3: 11
4: 154
Right 1018686365 6:166307593-166307615 CGGCCCTAGCCGGGAGACACGGG 0: 1
1: 0
2: 0
3: 8
4: 84
1018686358_1018686372 8 Left 1018686358 6:166307579-166307601 CCTCCGCGGGCCCGCGGCCCTAG 0: 1
1: 0
2: 1
3: 11
4: 154
Right 1018686372 6:166307610-166307632 CACGGGGCGAGTAGGCGCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1018686358_1018686377 25 Left 1018686358 6:166307579-166307601 CCTCCGCGGGCCCGCGGCCCTAG 0: 1
1: 0
2: 1
3: 11
4: 154
Right 1018686377 6:166307627-166307649 CCTGGGTTCGGCCGAGGGTGAGG 0: 1
1: 0
2: 0
3: 13
4: 171
1018686358_1018686378 26 Left 1018686358 6:166307579-166307601 CCTCCGCGGGCCCGCGGCCCTAG 0: 1
1: 0
2: 1
3: 11
4: 154
Right 1018686378 6:166307628-166307650 CTGGGTTCGGCCGAGGGTGAGGG 0: 1
1: 0
2: 1
3: 9
4: 114
1018686358_1018686370 0 Left 1018686358 6:166307579-166307601 CCTCCGCGGGCCCGCGGCCCTAG 0: 1
1: 0
2: 1
3: 11
4: 154
Right 1018686370 6:166307602-166307624 CCGGGAGACACGGGGCGAGTAGG 0: 1
1: 0
2: 0
3: 8
4: 95
1018686358_1018686374 19 Left 1018686358 6:166307579-166307601 CCTCCGCGGGCCCGCGGCCCTAG 0: 1
1: 0
2: 1
3: 11
4: 154
Right 1018686374 6:166307621-166307643 TAGGCGCCTGGGTTCGGCCGAGG 0: 1
1: 0
2: 1
3: 1
4: 41
1018686358_1018686366 -8 Left 1018686358 6:166307579-166307601 CCTCCGCGGGCCCGCGGCCCTAG 0: 1
1: 0
2: 1
3: 11
4: 154
Right 1018686366 6:166307594-166307616 GGCCCTAGCCGGGAGACACGGGG 0: 1
1: 0
2: 0
3: 9
4: 72
1018686358_1018686373 13 Left 1018686358 6:166307579-166307601 CCTCCGCGGGCCCGCGGCCCTAG 0: 1
1: 0
2: 1
3: 11
4: 154
Right 1018686373 6:166307615-166307637 GGCGAGTAGGCGCCTGGGTTCGG 0: 1
1: 0
2: 1
3: 6
4: 78
1018686358_1018686375 20 Left 1018686358 6:166307579-166307601 CCTCCGCGGGCCCGCGGCCCTAG 0: 1
1: 0
2: 1
3: 11
4: 154
Right 1018686375 6:166307622-166307644 AGGCGCCTGGGTTCGGCCGAGGG 0: 1
1: 0
2: 0
3: 4
4: 55
1018686358_1018686371 7 Left 1018686358 6:166307579-166307601 CCTCCGCGGGCCCGCGGCCCTAG 0: 1
1: 0
2: 1
3: 11
4: 154
Right 1018686371 6:166307609-166307631 ACACGGGGCGAGTAGGCGCCTGG 0: 1
1: 0
2: 0
3: 1
4: 39
1018686358_1018686364 -10 Left 1018686358 6:166307579-166307601 CCTCCGCGGGCCCGCGGCCCTAG 0: 1
1: 0
2: 1
3: 11
4: 154
Right 1018686364 6:166307592-166307614 GCGGCCCTAGCCGGGAGACACGG 0: 1
1: 0
2: 0
3: 4
4: 72
1018686358_1018686379 27 Left 1018686358 6:166307579-166307601 CCTCCGCGGGCCCGCGGCCCTAG 0: 1
1: 0
2: 1
3: 11
4: 154
Right 1018686379 6:166307629-166307651 TGGGTTCGGCCGAGGGTGAGGGG 0: 1
1: 0
2: 1
3: 3
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018686358 Original CRISPR CTAGGGCCGCGGGCCCGCGG AGG (reversed) Exonic
900556646 1:3284029-3284051 CTAGGGTAGCGGGCCTGGGGGGG + Intronic
903263355 1:22142927-22142949 CCCGGGCCGGGCGCCCGCGGCGG - Exonic
903860138 1:26360133-26360155 CTAGGGGGGCGGGCCGGAGGAGG - Intergenic
905639209 1:39576887-39576909 CTCGGCCCGGGGGCCCGAGGCGG + Intergenic
906627024 1:47333822-47333844 CCACGGCGGCGGGGCCGCGGCGG + Exonic
908501116 1:64744908-64744930 CCGGGGCCGGGGGCCGGCGGGGG + Intergenic
910251304 1:85201298-85201320 CTCGGGCCTCGGCCGCGCGGCGG - Intergenic
912416234 1:109509760-109509782 CTCGGGGCGCGTGCGCGCGGCGG + Intergenic
913131030 1:115838646-115838668 CCAGGGCCACAGGCCCGCTGTGG - Exonic
915171062 1:153977510-153977532 CTAGGGCCGCGAGCCCCCGCCGG - Exonic
918497676 1:185157552-185157574 CGGAGCCCGCGGGCCCGCGGCGG + Intronic
921222015 1:212980062-212980084 CTAGGGCCGGGGGCCTGAGATGG + Intronic
924527073 1:244863057-244863079 CGGGGAGCGCGGGCCCGCGGGGG - Intronic
1063929783 10:11017819-11017841 CTGGGCCGGCGGGCCCGCAGGGG + Intronic
1064208841 10:13347422-13347444 CCCGGGCTGCGGGCCGGCGGCGG + Intronic
1064209020 10:13347928-13347950 CTGGGTCCGCAGGCCCGCGGCGG - Intronic
1064274207 10:13891785-13891807 CTGACGCCGAGGGCCCGCGGCGG - Intronic
1066370498 10:34815112-34815134 CTAGGGGCGCGGGCAGGCGGCGG + Exonic
1067071862 10:43138392-43138414 GCGGGGCCGCGGGCGCGCGGCGG + Intergenic
1070810175 10:79293589-79293611 CTGGGGCCGGGGGCCCGGGTAGG - Exonic
1072757510 10:98030689-98030711 CTGGAGCCGGGGGCCCGGGGTGG + Exonic
1072914237 10:99527333-99527355 CTAGGGCCCCAGGCCCTTGGCGG + Intergenic
1074169741 10:110920017-110920039 CGCGGGCCGGGGGCCCCCGGCGG + Intronic
1077008400 11:369605-369627 CCTCGGCCGCGGGCCCGGGGTGG - Intergenic
1077053004 11:576096-576118 GTGGGGCTGCGGGCCCGAGGAGG + Intergenic
1077101485 11:824457-824479 CTAGCACCGCGGGCCCCGGGTGG - Intronic
1079122498 11:17695872-17695894 CTAAGGCCGCGCGCCCACTGCGG - Intergenic
1081705652 11:45180854-45180876 GCAGGGCCGGGGGCGCGCGGTGG - Intronic
1083667884 11:64285385-64285407 GCAGGGCCGCGGGCGCGCCGGGG + Intronic
1084395029 11:68903928-68903950 CTAGGGGCCCAGGCCGGCGGCGG + Exonic
1084636911 11:70398796-70398818 CGAGGGCCGGGGGTCCGCGAGGG + Intronic
1094470280 12:30796239-30796261 CTGCGGCCGCGGGGCGGCGGGGG - Intergenic
1095949441 12:47773770-47773792 CCAGCGCCGCGGGCGCGCGGAGG - Intronic
1098342956 12:69470555-69470577 GGACGGCCGCGGGCCCGCGTCGG + Intronic
1101037191 12:100717341-100717363 CTAGAGCTGCCGGCGCGCGGGGG - Intergenic
1102571658 12:113830561-113830583 CTAGGGCTGCGGGGCGGGGGGGG + Intronic
1103344750 12:120241756-120241778 CAAGGGCCGAGGGCCCACTGGGG + Intronic
1103488192 12:121296736-121296758 CCCGGGCGGCGGGCGCGCGGGGG + Intronic
1104021266 12:124993887-124993909 CAGGGGGCGCGGGGCCGCGGCGG + Exonic
1107468137 13:40667076-40667098 CGAGGGCCGGGGGCGCGGGGTGG + Intergenic
1117302165 14:54440918-54440940 GCAGGGCCGCGGGCCGGCAGAGG + Intronic
1119500899 14:75126794-75126816 CAGGGGCCGCGAGCCGGCGGCGG - Exonic
1121546554 14:94767785-94767807 CTAAGGCGGCGGGTCCACGGGGG - Intergenic
1124587901 15:31026101-31026123 CTTGGCTCACGGGCCCGCGGTGG + Intronic
1124648121 15:31454185-31454207 CCAGGGCGCCGGGCCCGGGGAGG - Intergenic
1129330890 15:74826586-74826608 CGTGGGGCGCGGGCCCGCGGCGG + Exonic
1129710598 15:77818784-77818806 CTAGGCCCGCGGCGCCGCGCTGG - Intronic
1132589684 16:721214-721236 CGAGGGCCGCGGACCCGAGCCGG + Exonic
1132683562 16:1153312-1153334 CTGGGGACGCGGGCCGGGGGCGG + Exonic
1132719648 16:1309481-1309503 CCCGGGGCGCGGGCGCGCGGCGG + Intronic
1132821180 16:1872036-1872058 CCAGGTCCGCGAGGCCGCGGCGG - Exonic
1133121564 16:3611707-3611729 CGCCGGGCGCGGGCCCGCGGCGG + Intronic
1134070052 16:11255353-11255375 GCACGGCCGCGGGCGCGCGGGGG + Exonic
1136141859 16:28293273-28293295 CTGGGGCCGCGGGGACGCCGCGG - Exonic
1137617468 16:49856167-49856189 CAGGGGCCGGGGGCCGGCGGGGG - Intronic
1137787755 16:51151888-51151910 CGAGGCGCGCCGGCCCGCGGGGG + Intergenic
1138651461 16:58463685-58463707 CTGCAGCCGCGGGCACGCGGAGG + Intronic
1142293018 16:89201349-89201371 CGCGGGGCGCGGGCCCGGGGCGG + Intronic
1142319533 16:89372093-89372115 CGAGGGCCGGGTGCCCGCCGTGG - Intronic
1142376801 16:89710803-89710825 CTGGGGCCGCGGGGCTGCGCTGG + Exonic
1142513156 17:410521-410543 GCGGCGCCGCGGGCCCGCGGGGG + Exonic
1142550095 17:732883-732905 CTCGGGCCGCCGGGACGCGGAGG - Intronic
1142631710 17:1229841-1229863 CTCGGGCCGCGGAGCCGCCGGGG + Intergenic
1143512847 17:7405501-7405523 CTGGGCCTGCGGGGCCGCGGGGG + Intronic
1144775309 17:17782165-17782187 CGGGGGCCGCGGGCCAGGGGAGG + Intronic
1145225793 17:21127097-21127119 CTAAGGCCGCGGGCCCTGGGCGG + Intronic
1145243526 17:21253054-21253076 GCCGGGCCGCGGGCGCGCGGGGG + Intronic
1145884351 17:28372014-28372036 CCATGGGCGCGGGGCCGCGGGGG - Exonic
1147183963 17:38703970-38703992 CAAGGGCCTGGGGCCCGCCGCGG - Intergenic
1148617817 17:49013836-49013858 CAAGGGCCGCGGGTCCCCGCCGG + Intronic
1148759695 17:49993361-49993383 CCAGGGCCGCGGGGGCGCGCGGG - Intronic
1151324286 17:73369337-73369359 CTGGTGCAGCGGGCCCGGGGTGG - Intronic
1151597530 17:75087685-75087707 CTAGGGCCCCGGGCTTGGGGCGG - Intergenic
1151896834 17:76986425-76986447 CTAGGGCCTTGGGCCAGGGGAGG - Intergenic
1152133464 17:78490970-78490992 CTAGGGCTGTGGGCCAGGGGTGG - Intronic
1152936536 17:83140429-83140451 TGAGGGCCGCGGGCCCTCGCTGG + Intergenic
1153285375 18:3450914-3450936 CCGGGGCCGCGGGACCGCCGCGG + Intronic
1155507544 18:26548097-26548119 CTGGCGCCCCGGGCCCGCGGTGG - Intronic
1158649673 18:59273861-59273883 CCAGGGTGGCGGCCCCGCGGAGG - Intronic
1160164041 18:76495088-76495110 CAGGGGCCGCGGGCGGGCGGTGG - Intronic
1160499096 18:79393806-79393828 GCAGAGCCGGGGGCCCGCGGTGG + Intergenic
1160691054 19:460846-460868 CCTGGGCCGCGGCCCGGCGGCGG - Exonic
1160778259 19:866595-866617 CGAGGGGTGCAGGCCCGCGGCGG - Intergenic
1160778276 19:866646-866668 CGAGGGGTGCAGGCCCGCGGCGG - Intergenic
1160778293 19:866697-866719 CGAGGGGTGCAGGCCCGCGGCGG - Intergenic
1160778327 19:866799-866821 TGAGGGGTGCGGGCCCGCGGCGG - Intergenic
1160778343 19:866850-866872 CGAGGGGTGCGGGCCCGCAGTGG - Intergenic
1160778358 19:866901-866923 CGAGGGGTGCGGGCCCGCAGTGG - Intergenic
1160778373 19:866952-866974 CGAGGGGTGCGGGCCCGCAGTGG - Intergenic
1160863993 19:1249298-1249320 CTAGGGCCGCGGCCCCGGGGAGG - Intronic
1160928054 19:1556330-1556352 CCAGGGCCGTGTCCCCGCGGAGG + Exonic
1160960627 19:1719113-1719135 GCAGGGCCGCGGTCCCGCGTGGG - Intergenic
1161560391 19:4969505-4969527 CCCGGGCCGGGGGCGCGCGGGGG + Intronic
1163145864 19:15379199-15379221 CTAGGCCCGCGGGGCCGTGTAGG - Intronic
1164834557 19:31349284-31349306 AGGGGGCGGCGGGCCCGCGGGGG + Exonic
1165750445 19:38256269-38256291 CCTGGCCCGCGGGCCCGCGATGG + Exonic
1167042741 19:47032285-47032307 CCAGCGCTGCGGGGCCGCGGCGG - Exonic
1167495712 19:49817631-49817653 CAAGGGCAGCGGGCCCGGCGCGG + Intergenic
1168078487 19:53992921-53992943 GGGGGGCCGCGGGCCGGCGGCGG + Exonic
1168297345 19:55383858-55383880 CGCGGGGCGCTGGCCCGCGGCGG + Exonic
1168315164 19:55481897-55481919 CTGGGGGGGCGGGGCCGCGGAGG - Exonic
926268145 2:11344545-11344567 CCATGGCAGCGGGCCGGCGGCGG - Exonic
928186508 2:29115611-29115633 CTGGGGACGCGGGGGCGCGGAGG - Exonic
929452906 2:42048415-42048437 CGGGGGCCCCGGGCCCGGGGCGG + Exonic
930136359 2:47906540-47906562 GGAGGGCCGCGGGGCGGCGGGGG + Intergenic
931052301 2:58428473-58428495 CGCCGGCCGCGGGCCCGGGGCGG + Intergenic
932599197 2:73112484-73112506 CCAGGGCGCCGGGCCCGCGTCGG + Exonic
937221039 2:120343569-120343591 CCGGGACCGCAGGCCCGCGGCGG - Intergenic
937325726 2:120988749-120988771 CTATGGCCACGGCCACGCGGGGG + Exonic
937904831 2:127047920-127047942 CCAGGGCAGCGGGCCTTCGGGGG + Intergenic
941979086 2:171434731-171434753 GGAGGGCCGCGGGCGCGCGGCGG + Exonic
942277657 2:174334773-174334795 CTAGGGCCGCGGGGGTGGGGGGG - Intergenic
946747570 2:222861214-222861236 CTCCGGCCTCGGGCCCGCGCAGG - Exonic
947741925 2:232488533-232488555 CTAGGGCTGCTGGCCAGAGGGGG - Intergenic
948487207 2:238288583-238288605 CGAGGCCCGCGCGCCGGCGGCGG + Exonic
1170889652 20:20367319-20367341 CTAGCCCCGTGGGCGCGCGGAGG + Intergenic
1171173582 20:23035402-23035424 CTCGGGCGGCGGGCCCAGGGCGG - Exonic
1172006198 20:31820316-31820338 CAGGGGCGGGGGGCCCGCGGAGG + Exonic
1172320888 20:33994320-33994342 CTGGGGCCGGGGACCCGGGGCGG - Intronic
1176216660 20:63951315-63951337 CTAGGACCGCAGGCCTGCGGAGG + Intronic
1179675206 21:42975727-42975749 CCAGGGCTGCGGCCCCGCCGTGG - Intronic
1181162048 22:20965151-20965173 TTGGGGCCGCGGGCGCGGGGGGG - Exonic
1183577352 22:38700605-38700627 CTCTGGCCGCGGCCCTGCGGAGG + Exonic
1184712736 22:46262801-46262823 CTGGGGCCGCGGGCCTGGCGCGG + Exonic
950550124 3:13661300-13661322 CTAGAGCCCCGGGGCCGGGGTGG + Intergenic
954149098 3:48648379-48648401 CTGGGGCAGCGGGCCCCTGGGGG - Exonic
954316218 3:49803198-49803220 CTTTGGCCGCGGGGCCGGGGCGG + Intergenic
954382452 3:50226975-50226997 CTAGGGCCGCTGCGCCGTGGGGG - Intronic
955365570 3:58307078-58307100 CTAGAGCCGAGGCCCAGCGGTGG + Intronic
966911565 3:184562718-184562740 CGAGGGCCGCGGGGCTGTGGCGG + Intronic
967087664 3:186109154-186109176 CTAGGGCCGCGGGCCAATGGCGG - Intronic
968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG + Intronic
969087758 4:4669253-4669275 CTAGGGCCTCGGGAACGAGGCGG - Intergenic
973293378 4:48490873-48490895 GGAGGGGCCCGGGCCCGCGGCGG + Exonic
974047347 4:56908612-56908634 GGAGGGCCGCGGGCCGGCGCGGG - Intronic
979632805 4:122922500-122922522 CTACGGCCCCGGGCCTTCGGCGG - Exonic
982157213 4:152535274-152535296 CGAGGGCGGCGGGGCCGGGGGGG - Exonic
984889047 4:184474918-184474940 CGGGGGGCGCAGGCCCGCGGCGG + Intergenic
985629929 5:1008979-1009001 CCGGGGCCGGGAGCCCGCGGGGG - Exonic
985696794 5:1345277-1345299 CTAGGGCCGCGGGGTCCCCGGGG + Intergenic
994696594 5:103079688-103079710 CTAGGGGCTCAGGCCCACGGAGG + Intergenic
1001382261 5:171312395-171312417 CGAAGGCCGCGGGCCAGCGCCGG + Intergenic
1003218343 6:4135574-4135596 CTAGGGCTGCGGGGGCTCGGGGG + Exonic
1004216781 6:13711251-13711273 CGGGGGCGGCGGGGCCGCGGTGG + Exonic
1018686358 6:166307579-166307601 CTAGGGCCGCGGGCCCGCGGAGG - Exonic
1019476447 7:1246873-1246895 CTCCGGCCGCCGGCCTGCGGGGG - Intergenic
1020101602 7:5397141-5397163 CTCGGGCCCCGGGGCCTCGGTGG + Intronic
1020130499 7:5556335-5556357 CAGGGGCCGCGGGCCGGGGGCGG - Intronic
1021027310 7:15685962-15685984 CTGGGGCCGCGTGCGCGCCGGGG - Exonic
1022094442 7:27130197-27130219 CAAGAGCAGCGGGCACGCGGGGG + Exonic
1024579828 7:50792977-50792999 CTGGGGCTGCGGGCGCGCGGCGG - Intronic
1034560624 7:151877328-151877350 CTGGGGCCGCGGCGCGGCGGGGG - Intergenic
1036664307 8:10729129-10729151 CTAAAGCCGCAGGCCCGCAGAGG - Intronic
1038726016 8:30083150-30083172 CCAGGGGCGGGGGCCCACGGCGG - Exonic
1045277474 8:100721297-100721319 GTAGGCCGGCGGGCCCGGGGAGG - Intronic
1047259225 8:123241160-123241182 CCGGGGCCGGGGCCCCGCGGAGG + Intronic
1049620763 8:143597466-143597488 CACGGGCCGGGGGCCCGGGGGGG + Exonic
1054336283 9:63813098-63813120 CTAGACCCGCGGCCCCGGGGTGG + Intergenic
1054835648 9:69672540-69672562 CGCGGCCCGCGAGCCCGCGGCGG + Intergenic
1056655135 9:88502850-88502872 GGAGGGCAGCGGGCCCGGGGTGG + Intergenic
1057061020 9:92003942-92003964 CTCGGGCTGCGGGCCCCTGGCGG + Intergenic
1061851352 9:133417891-133417913 CCAGGGCGCCGGGCCCGGGGAGG - Exonic
1062616189 9:137397050-137397072 CTGGGGCCGCGGGTCCTGGGAGG - Intronic
1187172900 X:16869670-16869692 CAAGGGCCGCGACCCCGAGGCGG + Exonic
1192496000 X:71616970-71616992 CGCGGGCCGGGGGCCCCCGGCGG + Exonic
1195278909 X:103310718-103310740 CAAGGCTCGCGGTCCCGCGGCGG + Exonic
1200173626 X:154097221-154097243 CCGGGGCCGCGGGCGCGCGACGG + Intronic