ID: 1018687163

View in Genome Browser
Species Human (GRCh38)
Location 6:166312273-166312295
Sequence CCTAACCCCCACATTGCTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018687157_1018687163 -3 Left 1018687157 6:166312253-166312275 CCCTATGGGAGGCTGGTACCCCT No data
Right 1018687163 6:166312273-166312295 CCTAACCCCCACATTGCTTAGGG No data
1018687158_1018687163 -4 Left 1018687158 6:166312254-166312276 CCTATGGGAGGCTGGTACCCCTA No data
Right 1018687163 6:166312273-166312295 CCTAACCCCCACATTGCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018687163 Original CRISPR CCTAACCCCCACATTGCTTA GGG Intergenic
No off target data available for this crispr