ID: 1018690072

View in Genome Browser
Species Human (GRCh38)
Location 6:166337503-166337525
Sequence CGGCAGAGGAGACCCCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 1, 2: 3, 3: 16, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018690072_1018690075 -3 Left 1018690072 6:166337503-166337525 CCTGCTTGGGGTCTCCTCTGCCG 0: 1
1: 1
2: 3
3: 16
4: 168
Right 1018690075 6:166337523-166337545 CCGCCTTAGCTCCTTCTACCTGG 0: 1
1: 0
2: 1
3: 6
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018690072 Original CRISPR CGGCAGAGGAGACCCCAAGC AGG (reversed) Intronic
900703912 1:4063995-4064017 CTGCAGAGGATGCCTCAAGCTGG - Intergenic
902233691 1:15044268-15044290 GGGCAGAGCAGAACACAAGCAGG + Intronic
902305045 1:15530532-15530554 GGACAGAGGTGACTCCAAGCTGG + Intronic
904351018 1:29906793-29906815 GGGCCGAGGAGACCTCAGGCTGG - Intergenic
904480024 1:30787792-30787814 CGGCAGAGGAGCCAGGAAGCAGG - Intergenic
904824170 1:33264003-33264025 AGACAGAGCAGGCCCCAAGCAGG - Intronic
906495568 1:46302272-46302294 GGGCCAAGGAGGCCCCAAGCGGG - Intronic
908088508 1:60662060-60662082 AGGCAGAGGAGACCCCAAAGAGG - Intergenic
910479077 1:87638816-87638838 GGGCAGGGGAGCCCCCAAACTGG - Intergenic
915279858 1:154814999-154815021 TGGCAGAGGAGGCCCCCATCTGG + Intronic
919621361 1:199867691-199867713 GGGCAGAGGTGACCCAGAGCAGG + Intergenic
920314928 1:205070354-205070376 CTGCAGAGCAGCCCCCAACCAGG - Intronic
920745569 1:208624831-208624853 CAGGAGATGAGACCCAAAGCAGG + Intergenic
922586793 1:226739224-226739246 CGGCAGTGGCGACGCCAAGCCGG + Intronic
922849852 1:228723301-228723323 CAGGAGAGGAGACCCCAAGTGGG + Intergenic
924645105 1:245870350-245870372 CAGCACAGGAAACCCCACGCCGG + Intronic
1063697682 10:8352803-8352825 AGGCAGAGGAGAATCCAAGGAGG + Intergenic
1069848820 10:71391735-71391757 TGACAGAGGGGACCCCGAGCAGG - Intergenic
1072743371 10:97923523-97923545 CGGCAAGGAAGACCTCAAGCAGG + Intronic
1073104943 10:101027220-101027242 GGGCAGAGGAAAGCCCAGGCAGG - Intronic
1074695345 10:116045515-116045537 CAGGAGGGGTGACCCCAAGCTGG + Intergenic
1075800601 10:125151511-125151533 CAGGAGACGAGATCCCAAGCCGG + Intronic
1076462569 10:130656638-130656660 AGGCAGAGTGGACCCCGAGCGGG + Intergenic
1077282120 11:1750545-1750567 AGGCAGACAGGACCCCAAGCAGG - Exonic
1077713106 11:4555185-4555207 GGTCAGAGGAGACACTAAGCGGG + Intergenic
1078375740 11:10791857-10791879 TGGCAGAGGGGAGGCCAAGCTGG - Intergenic
1081659018 11:44876513-44876535 TGGCTGAGGAGACATCAAGCTGG + Intronic
1084632171 11:70360095-70360117 AGGCAGAGGAGACCCCATCTGGG - Intronic
1084871709 11:72103029-72103051 TTACAGAGGAGACGCCAAGCCGG - Intronic
1085198900 11:74689542-74689564 CAGCTGGGGAGACTCCAAGCTGG + Intergenic
1086089709 11:82993222-82993244 TGGCAGAGGAGACCCCAGAAAGG + Intronic
1086226041 11:84510947-84510969 CGAAAGAGGAGACCCCTACCAGG + Intronic
1090400133 11:126443650-126443672 TGGCTGAGGAGACACCAAGCTGG + Intronic
1091048618 11:132348153-132348175 TTGCAGAGGAGACCCTGAGCAGG - Intergenic
1092471690 12:8787125-8787147 AGGCAGAGGAGGCGCCAAGAGGG - Intergenic
1101285330 12:103306124-103306146 AGCCAGAGGAGCACCCAAGCAGG - Exonic
1101759336 12:107646040-107646062 TGGGGGAGGAGACCCGAAGCAGG - Intronic
1101873162 12:108581863-108581885 CGCGGGAGGAGAACCCAAGCTGG - Intergenic
1102173037 12:110856491-110856513 GGGCAGAAGAGTCCCCAGGCTGG + Intronic
1103775585 12:123364565-123364587 CGGCGAGGGAGGCCCCAAGCCGG + Intronic
1106226960 13:27793131-27793153 GGGCAGAGGTGATCCGAAGCAGG + Intronic
1109630136 13:65034469-65034491 CGGCAGGTGAGAGCCCCAGCGGG + Intergenic
1111347333 13:86975139-86975161 GAGCAGAGGAGACCCCTAGTGGG - Intergenic
1113307119 13:109090613-109090635 CAGCAGAGGAGACCCACAGCAGG + Intronic
1113592863 13:111513018-111513040 CGGCTGAGGTGACCCCACGCTGG + Intergenic
1113784367 13:112994728-112994750 CCGCAGCGGCGACCCCAGGCAGG - Intronic
1114467013 14:22930364-22930386 CGGTACAAGAGACCCCACGCAGG + Intergenic
1118596106 14:67436753-67436775 TGGCAGAGAAGACACCAGGCAGG + Intergenic
1118742185 14:68747618-68747640 CAGCAGAGGAGAAGCCAATCAGG - Intergenic
1120850203 14:89162887-89162909 GGTCAGCGGAGACCCCAAGGAGG - Exonic
1121643424 14:95501487-95501509 CAGCAGAGGAAACACTAAGCTGG + Intergenic
1122822690 14:104355146-104355168 CGGCACAGCAGGCCCCAAGTTGG + Intergenic
1123490150 15:20774497-20774519 AGGCAGAGGAGAGGCAAAGCCGG - Intergenic
1123546651 15:21343584-21343606 AGGCAGAGGAGAGGCAAAGCCGG - Intergenic
1123937770 15:25202289-25202311 AGGAAGAGGTGACCCCCAGCGGG - Intergenic
1126382683 15:48065277-48065299 CTTTAGAGGAGACCCCAGGCTGG - Intergenic
1128800392 15:70493187-70493209 AGGCAGTGGAAACCCCCAGCAGG + Intergenic
1129051808 15:72787107-72787129 CTGCAGAAGAGAACCCAAGCAGG - Intergenic
1129171669 15:73811805-73811827 AAGCAGGGGAGACCCCAAGAGGG + Intergenic
1131622536 15:94082812-94082834 GGGCAGAGGAGACCCGAGCCCGG + Intergenic
1132327737 15:100985838-100985860 CTGCAAAGGAGTTCCCAAGCTGG + Intronic
1132400968 15:101505064-101505086 CGGCAGCTCAGACCCCAGGCGGG + Intronic
1202954982 15_KI270727v1_random:70799-70821 AGGCAGAGGAGAGGCAAAGCCGG - Intergenic
1132859575 16:2063435-2063457 CCGCAGAGGAGAGACCAGGCAGG - Intronic
1135476005 16:22775696-22775718 AGGCAGATGAGACCCCAGGAAGG + Intergenic
1137409159 16:48213390-48213412 AGGCAGAGGAGCGTCCAAGCAGG + Intronic
1138114261 16:54347924-54347946 GTGCAGGGGAGACACCAAGCTGG + Intergenic
1139472846 16:67187467-67187489 CAGCAGAGGTGACCCAAAGTGGG + Exonic
1141606116 16:85154295-85154317 TCTCAGAGGAGACCCCAAGTGGG + Intergenic
1142713808 17:1737336-1737358 CGGGAGAGGAGAGCCTCAGCAGG - Intronic
1144837017 17:18161847-18161869 GGGCAGAGGTGGGCCCAAGCTGG + Intronic
1145007060 17:19344028-19344050 CGGCAAGGGACACCCCACGCTGG - Intronic
1146652754 17:34616620-34616642 TGCCAGAGGAGAACCCAGGCTGG + Intronic
1147265484 17:39231940-39231962 CTGGAGAGGAGGCCCCACGCAGG + Intergenic
1152134727 17:78497215-78497237 TTCCAGAGGAGACCTCAAGCAGG - Intronic
1152153997 17:78621196-78621218 CCCAAGAGGAAACCCCAAGCTGG - Intergenic
1153166089 18:2263456-2263478 TGGCAGAGGAAACCCAGAGCAGG + Intergenic
1153816595 18:8795747-8795769 CGACAGAAGAGAACCCCAGCTGG - Intronic
1153914264 18:9732169-9732191 AGGCAGAGCAGAGCCCATGCTGG - Intronic
1157404773 18:47413691-47413713 GGGCTGAGGAGACCTCAGGCAGG - Intergenic
1158505803 18:58044813-58044835 CTGCAGGGGAGCCCCAAAGCGGG + Intronic
1160679851 19:407666-407688 CAGCAGAGGGGACCCGAAGGGGG + Exonic
1161531290 19:4791729-4791751 CGCCCGAGGAGACCCTAAGATGG + Exonic
1162219489 19:9164108-9164130 GGGCAGATGAGCCCCCAAACTGG + Intergenic
1163017429 19:14464962-14464984 AGGCAGAGGTTACCGCAAGCTGG + Intronic
1165201824 19:34150884-34150906 GAGCAGAGAAGACCCCAAACTGG + Intergenic
1167503984 19:49861922-49861944 GGGGAGAGAAGACCCCGAGCGGG + Intronic
925600872 2:5607663-5607685 GTGCAGAGGAGCCCTCAAGCAGG - Intergenic
925984043 2:9200796-9200818 AGGCAGAGGAGTCCCCATGAGGG + Intergenic
926440607 2:12884774-12884796 AGGCAGAGGAGCCCCAAACCTGG - Intergenic
927553492 2:24017615-24017637 CTGCAGAGGGGACCCCAGGTTGG - Intronic
932615251 2:73227351-73227373 CAGTAGAGGTGAGCCCAAGCTGG - Intergenic
936263321 2:110980435-110980457 GGGAAGAAGAGACCCCAAGAAGG + Intronic
938310098 2:130284118-130284140 GGCCAGAGGAGGCCCCAACCTGG - Intergenic
938444822 2:131368251-131368273 GGCCAGAGGAGGCCCCAACCTGG + Intergenic
940034067 2:149294833-149294855 CTGCAGAGGAGCCACCAAGGAGG + Intergenic
943094337 2:183410533-183410555 CAGAAGAAGAGACCCCTAGCAGG - Intergenic
946153171 2:217789763-217789785 GGAGAGAGGAGACCCCAAGGGGG + Intergenic
946355495 2:219182040-219182062 AACCAGAGGAGACCCTAAGCCGG + Exonic
948741734 2:240052702-240052724 CGACAGGGTAGAGCCCAAGCTGG + Intergenic
1169074542 20:2752691-2752713 CGGCAGGGGAGGTCCCAGGCGGG - Intronic
1172689246 20:36779055-36779077 CAGCAGAGGAGGCTCCAAGGAGG + Exonic
1174197682 20:48785279-48785301 TGTCAGAGGAGACCCCAGGCAGG - Intronic
1178607913 21:34055495-34055517 CGGCAGAGGTGACCCAAAGCTGG + Intergenic
1180707148 22:17816965-17816987 GGGCAGAGCTGACGCCAAGCGGG + Intronic
1180953830 22:19732544-19732566 GGGCAGAGAAGACCCCCAGGAGG - Intergenic
1181725891 22:24810670-24810692 AGGCAGATGAGACCCCAGGAAGG + Intronic
1183359022 22:37373812-37373834 CAGCAGTGGGGACCCCGAGCTGG - Exonic
1184387527 22:44184705-44184727 CGGCAGATGAGACCCCAGAAGGG + Intronic
1184981871 22:48100865-48100887 CGGCTGAGGTGACCCCCTGCAGG - Intergenic
949561627 3:5208002-5208024 GGGCAGAGGAGAGCCCAGGCAGG + Intronic
952306701 3:32153195-32153217 CTACAGATGAGACCCAAAGCTGG - Intronic
956273080 3:67468712-67468734 CTGCATAGCAGACTCCAAGCAGG + Intronic
957331759 3:78774090-78774112 TGGCAGATGAGAACCTAAGCAGG + Intronic
960055952 3:113276468-113276490 AGGCTGAGGAGACCCCAGGCTGG - Intronic
960845565 3:122001455-122001477 CTGCAGGGGAGAAGCCAAGCAGG + Intronic
968353460 3:198081197-198081219 CGGCAGAGGAGGAGCCGAGCGGG - Intergenic
968473029 4:790554-790576 AGGCTGAGGGGACCCCAAGGAGG - Intronic
968583941 4:1407247-1407269 CGCAAAAGGAGACCCCAAGCGGG - Intergenic
968743004 4:2340759-2340781 CGGCAGAGGACACCCCAACCAGG + Intronic
968752198 4:2396057-2396079 CTGCAGAGGGGACCCAAGGCGGG + Intronic
968752382 4:2396762-2396784 CTGCAGAGGGGACCCAAGGCGGG + Intronic
968764304 4:2460006-2460028 TGGTAGGGGAGGCCCCAAGCTGG - Intronic
968929936 4:3573488-3573510 CTGCAGAGGAGACACCAAGCGGG - Intergenic
969569157 4:7998503-7998525 CGACACAGGACACCCCAAGAAGG - Intronic
975741760 4:77436036-77436058 CTGCAGAGGAGAGCCAACGCTGG + Intergenic
976267237 4:83195685-83195707 CGAAAGAGGAGACCCCAAGTGGG - Intergenic
977871266 4:102093362-102093384 CAGCAGAGGACACAGCAAGCAGG + Intergenic
978522972 4:109635629-109635651 CGAAAGAGAAGACCCCAAGTGGG - Intronic
981005002 4:139865772-139865794 GGTCAGAGGAGGACCCAAGCAGG - Intronic
981135415 4:141206045-141206067 CAGCAAAGCAGACCCCAAGGTGG - Intronic
983756398 4:171342633-171342655 CGGCTCAGGACTCCCCAAGCAGG + Intergenic
985816603 5:2132388-2132410 CAGCAGAGGACACCCCATCCCGG + Intergenic
990966738 5:61456433-61456455 CGGCAGAGGTGACCCCACCAAGG + Intronic
991690125 5:69217702-69217724 CGGCGGAGGAGAGCCCAGTCCGG + Intergenic
995805807 5:116051252-116051274 CGGCAGAGGAGAGCCTCAGTAGG + Intronic
996310279 5:122096575-122096597 CGAAAGAGGAGACCCCAAGTGGG - Intergenic
997578953 5:135005255-135005277 AGGCTGAGCAGTCCCCAAGCAGG - Intronic
1007915891 6:45561382-45561404 GGGCAGAGGGGGCCCCAAGGAGG + Intronic
1016378666 6:143450584-143450606 CGGCAGAGGAGACCGAAAAGTGG - Exonic
1016781334 6:147962693-147962715 CTCAATAGGAGACCCCAAGCTGG - Intergenic
1017310125 6:152966429-152966451 AGGCAGAGGAGGCGCCAAGAGGG + Intergenic
1018206520 6:161441809-161441831 TGGCCGAGGAGCCCCCAGGCAGG - Intronic
1018690072 6:166337503-166337525 CGGCAGAGGAGACCCCAAGCAGG - Intronic
1018947354 6:168356905-168356927 CAGCAGGGGCGACCCCAGGCAGG + Intergenic
1018947486 6:168357345-168357367 CAGCAGGGGCGACCCCAGGCAGG + Intergenic
1018947538 6:168357510-168357532 CGGCAGGGGTGGCCCCAGGCAGG + Intergenic
1018947570 6:168357620-168357642 CGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947588 6:168357674-168357696 CGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947619 6:168357784-168357806 CAGCAGGGGCGACCCCAGGCAGG + Intergenic
1018947760 6:168358224-168358246 CGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947778 6:168358278-168358300 CGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947809 6:168358388-168358410 CAGCAGGGGCGACCCCAGGCAGG + Intergenic
1018947965 6:168358883-168358905 CGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947983 6:168358937-168358959 CGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1019456552 7:1130613-1130635 CGGCAGAGGAGACTGGGAGCTGG - Intronic
1019514622 7:1434288-1434310 AGGCAGGCGAGACCCCAGGCAGG + Intronic
1021716779 7:23469024-23469046 CGGCAGGGGAGACCACGAACGGG + Intronic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1025749749 7:64283202-64283224 CGGGAGGGCAGAGCCCAAGCAGG + Intergenic
1030323604 7:108195772-108195794 TGGGAGAGGAGACCCAAAGAAGG + Exonic
1032795142 7:135270591-135270613 CGGCAGTGATGACCCCAAACAGG + Intergenic
1034227979 7:149497637-149497659 CGGCAGAGGAAAGGCCAGGCAGG - Exonic
1035064604 7:156095655-156095677 CTGCGGAGCAGACCCCAGGCAGG + Intergenic
1036710307 8:11074283-11074305 AGACAGAGGAGACCCAAGGCCGG - Intronic
1036768534 8:11563877-11563899 CGGCAGAGGAGACCGCAAGCGGG - Intronic
1040537608 8:48323449-48323471 CTGCAGAGGAGACTCGATGCTGG + Intergenic
1042614562 8:70634092-70634114 AGGCAGAGGTGACGACAAGCAGG + Intronic
1049363320 8:142224674-142224696 TGGCAGAGCTGAGCCCAAGCTGG + Intronic
1049721271 8:144116540-144116562 GGGCAGAGGAGACCCATAGCGGG + Exonic
1051339599 9:16099331-16099353 TGGCAGAGGAGCCTCCAGGCTGG + Intergenic
1053350453 9:37410497-37410519 GGGCAGAGGGGATCCCAGGCGGG + Intergenic
1054460344 9:65458983-65459005 CTGCAGAGGAGACACCAAGTGGG + Intergenic
1061074240 9:128331503-128331525 TGGGAGAGAACACCCCAAGCTGG + Intronic
1061720635 9:132548953-132548975 GGGCCCAGGAGACCCGAAGCAGG - Intronic
1062188071 9:135229180-135229202 CAGCAGAGCAGAGCCCCAGCTGG - Intergenic
1062367337 9:136217116-136217138 CGGCAGAGGGGAAGCCCAGCGGG - Intronic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1062550883 9:137086076-137086098 CGGCTGGGGAGAACCCAGGCAGG + Intergenic
1185503422 X:615820-615842 AGAAAGAGGAGCCCCCAAGCCGG + Intergenic
1185894136 X:3843429-3843451 TGGCAGAGGAGACCCCGGACTGG - Exonic
1185899255 X:3881853-3881875 TGGCAGAGGAGACCCCGGACTGG - Intergenic
1185904372 X:3920282-3920304 TGGCAGAGGAGACCCCGGACTGG - Intergenic
1190495614 X:51025821-51025843 GAGCAGAGGTGACTCCAAGCTGG - Intergenic
1190510313 X:51167760-51167782 GAGCAGAGGTGACTCCAAGCTGG + Intergenic
1192585697 X:72316718-72316740 AGGCAGAGTAGACCCTCAGCAGG + Intergenic
1197662380 X:129188206-129188228 CAAGAGAGGAGACCCCAAGTCGG + Intergenic
1198111945 X:133509663-133509685 GGGCAGAGGAGACCCTAAGAGGG + Intergenic
1199541578 X:148963823-148963845 TGGCAGTGGAGACACGAAGCTGG + Intronic