ID: 1018695852

View in Genome Browser
Species Human (GRCh38)
Location 6:166390904-166390926
Sequence TACCAATGGTGGGTGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018695852_1018695861 -9 Left 1018695852 6:166390904-166390926 CCTGTCTCCACCCACCATTGGTA No data
Right 1018695861 6:166390918-166390940 CCATTGGTAGGAAGAGCAGGGGG No data
1018695852_1018695865 20 Left 1018695852 6:166390904-166390926 CCTGTCTCCACCCACCATTGGTA No data
Right 1018695865 6:166390947-166390969 ATCCTTATTGTAAGTAGGGGAGG No data
1018695852_1018695863 16 Left 1018695852 6:166390904-166390926 CCTGTCTCCACCCACCATTGGTA No data
Right 1018695863 6:166390943-166390965 CTGAATCCTTATTGTAAGTAGGG No data
1018695852_1018695867 25 Left 1018695852 6:166390904-166390926 CCTGTCTCCACCCACCATTGGTA No data
Right 1018695867 6:166390952-166390974 TATTGTAAGTAGGGGAGGAAAGG No data
1018695852_1018695859 -10 Left 1018695852 6:166390904-166390926 CCTGTCTCCACCCACCATTGGTA No data
Right 1018695859 6:166390917-166390939 ACCATTGGTAGGAAGAGCAGGGG No data
1018695852_1018695864 17 Left 1018695852 6:166390904-166390926 CCTGTCTCCACCCACCATTGGTA No data
Right 1018695864 6:166390944-166390966 TGAATCCTTATTGTAAGTAGGGG No data
1018695852_1018695862 15 Left 1018695852 6:166390904-166390926 CCTGTCTCCACCCACCATTGGTA No data
Right 1018695862 6:166390942-166390964 TCTGAATCCTTATTGTAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018695852 Original CRISPR TACCAATGGTGGGTGGAGAC AGG (reversed) Intergenic
No off target data available for this crispr