ID: 1018698428

View in Genome Browser
Species Human (GRCh38)
Location 6:166408309-166408331
Sequence GCACTTCTGGGTACAGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018698422_1018698428 1 Left 1018698422 6:166408285-166408307 CCTCTTTCAGTAGGCATTTTTTG No data
Right 1018698428 6:166408309-166408331 GCACTTCTGGGTACAGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018698428 Original CRISPR GCACTTCTGGGTACAGCAGG AGG Intergenic
No off target data available for this crispr