ID: 1018698463

View in Genome Browser
Species Human (GRCh38)
Location 6:166408602-166408624
Sequence CAGTCTGCACTGTTGGTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018698463_1018698472 24 Left 1018698463 6:166408602-166408624 CCAAGGACCAACAGTGCAGACTG No data
Right 1018698472 6:166408649-166408671 ATGGGCATGCTGAGGCCAGGTGG No data
1018698463_1018698467 1 Left 1018698463 6:166408602-166408624 CCAAGGACCAACAGTGCAGACTG No data
Right 1018698467 6:166408626-166408648 CTTTATGTCTGTATTAAGAAGGG No data
1018698463_1018698471 21 Left 1018698463 6:166408602-166408624 CCAAGGACCAACAGTGCAGACTG No data
Right 1018698471 6:166408646-166408668 GGGATGGGCATGCTGAGGCCAGG No data
1018698463_1018698466 0 Left 1018698463 6:166408602-166408624 CCAAGGACCAACAGTGCAGACTG No data
Right 1018698466 6:166408625-166408647 GCTTTATGTCTGTATTAAGAAGG No data
1018698463_1018698469 6 Left 1018698463 6:166408602-166408624 CCAAGGACCAACAGTGCAGACTG No data
Right 1018698469 6:166408631-166408653 TGTCTGTATTAAGAAGGGATGGG No data
1018698463_1018698468 5 Left 1018698463 6:166408602-166408624 CCAAGGACCAACAGTGCAGACTG No data
Right 1018698468 6:166408630-166408652 ATGTCTGTATTAAGAAGGGATGG No data
1018698463_1018698470 16 Left 1018698463 6:166408602-166408624 CCAAGGACCAACAGTGCAGACTG No data
Right 1018698470 6:166408641-166408663 AAGAAGGGATGGGCATGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018698463 Original CRISPR CAGTCTGCACTGTTGGTCCT TGG (reversed) Intergenic
No off target data available for this crispr