ID: 1018698548

View in Genome Browser
Species Human (GRCh38)
Location 6:166409318-166409340
Sequence GGAGCTATCCAGACTGTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018698541_1018698548 9 Left 1018698541 6:166409286-166409308 CCTGAAGCCAGCGGGAGGGGCCA No data
Right 1018698548 6:166409318-166409340 GGAGCTATCCAGACTGTTATTGG No data
1018698543_1018698548 2 Left 1018698543 6:166409293-166409315 CCAGCGGGAGGGGCCAGAGGAGT No data
Right 1018698548 6:166409318-166409340 GGAGCTATCCAGACTGTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018698548 Original CRISPR GGAGCTATCCAGACTGTTAT TGG Intergenic
No off target data available for this crispr