ID: 1018699219

View in Genome Browser
Species Human (GRCh38)
Location 6:166413304-166413326
Sequence CTGGACTCATTTGGAGGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018699213_1018699219 4 Left 1018699213 6:166413277-166413299 CCTGGACTTTGGCCACTGTTGAG 0: 1
1: 0
2: 3
3: 14
4: 133
Right 1018699219 6:166413304-166413326 CTGGACTCATTTGGAGGAACAGG No data
1018699212_1018699219 5 Left 1018699212 6:166413276-166413298 CCCTGGACTTTGGCCACTGTTGA 0: 1
1: 0
2: 2
3: 6
4: 179
Right 1018699219 6:166413304-166413326 CTGGACTCATTTGGAGGAACAGG No data
1018699211_1018699219 12 Left 1018699211 6:166413269-166413291 CCAGTCACCCTGGACTTTGGCCA 0: 1
1: 0
2: 0
3: 28
4: 214
Right 1018699219 6:166413304-166413326 CTGGACTCATTTGGAGGAACAGG No data
1018699209_1018699219 18 Left 1018699209 6:166413263-166413285 CCAGGGCCAGTCACCCTGGACTT 0: 1
1: 1
2: 8
3: 24
4: 201
Right 1018699219 6:166413304-166413326 CTGGACTCATTTGGAGGAACAGG No data
1018699216_1018699219 -8 Left 1018699216 6:166413289-166413311 CCACTGTTGAGGAGTCTGGACTC 0: 1
1: 0
2: 1
3: 18
4: 221
Right 1018699219 6:166413304-166413326 CTGGACTCATTTGGAGGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018699219 Original CRISPR CTGGACTCATTTGGAGGAAC AGG Intronic
No off target data available for this crispr