ID: 1018702828

View in Genome Browser
Species Human (GRCh38)
Location 6:166440867-166440889
Sequence TGAGTATTCTTGGGGAAAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 1, 2: 21, 3: 64, 4: 267}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018702821_1018702828 -7 Left 1018702821 6:166440851-166440873 CCGCAAGTGCCGCCGGTGAGTAT 0: 2
1: 0
2: 11
3: 18
4: 65
Right 1018702828 6:166440867-166440889 TGAGTATTCTTGGGGAAAACGGG 0: 1
1: 1
2: 21
3: 64
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018702828 Original CRISPR TGAGTATTCTTGGGGAAAAC GGG Intronic
900464289 1:2816979-2817001 TGAGTATTCTCAGGGCAAATGGG - Intergenic
900844531 1:5086162-5086184 GCAGTATTCTTGGGGCAAATGGG - Intergenic
900963211 1:5939126-5939148 CCAGTATTCTCGGGGCAAACTGG + Intronic
902111166 1:14079737-14079759 TGAGTATTCTCGGAGCAAATGGG + Intergenic
902354345 1:15886334-15886356 TGAATATTGTGGGGGAAAATAGG + Intronic
902862051 1:19253535-19253557 TGAGAATAGTTGGGGAAGACAGG + Intronic
904502325 1:30921327-30921349 TGATTATTTTTGGTAAAAACAGG - Intergenic
906618299 1:47251069-47251091 TGAAGATACTTAGGGAAAACAGG - Exonic
906717222 1:47979204-47979226 TGAGTATCCTGGTAGAAAACAGG - Intronic
908581331 1:65520300-65520322 TGGGTATTCTCTGGGCAAACCGG - Intronic
908887943 1:68811433-68811455 TGAGCATCCTTGGGGAAAGCTGG + Intergenic
910589205 1:88911328-88911350 TGAGTATTTTTAGGGCAAACAGG - Intergenic
910798379 1:91120809-91120831 TGAGCATGCTCAGGGAAAACTGG - Intergenic
910990317 1:93049229-93049251 TGAGTATTCTCTGGGCAAATGGG + Intergenic
911037493 1:93566205-93566227 TGAGAGACCTTGGGGAAAACTGG - Intronic
911057358 1:93720398-93720420 TGTGTGCTCTTGGGCAAAACAGG + Intronic
915035842 1:152924114-152924136 TGTGTATTCCTGTGGATAACAGG + Intergenic
915905571 1:159874428-159874450 ACAGTATTCTTCGGGTAAACTGG - Intronic
917777387 1:178352339-178352361 CAAGTATTCTTGGGGCAAACAGG + Intronic
918128955 1:181608247-181608269 TGGGTATTATTTGGGAAGACAGG + Intronic
918403335 1:184187072-184187094 CAAGTATTCTTGGGGCAAATGGG - Intergenic
919068125 1:192719118-192719140 TGAGTATTCTTTGGGCAAATGGG - Intergenic
919364734 1:196643727-196643749 CTAGTATTCTTGGGTCAAACAGG + Intergenic
920454542 1:206089002-206089024 AAAGTATTCTTGAGGGAAACAGG - Intronic
921359200 1:214314802-214314824 TGGTTGTTTTTGGGGAAAACTGG + Exonic
923522093 1:234743015-234743037 TGAGTCTTGTTGGAGAAAACGGG + Intergenic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
1063048033 10:2414297-2414319 TGAGTATTCTCCGAGAAAACTGG + Intergenic
1063177497 10:3565265-3565287 CAAGTATTCTTGGGGCAAATGGG - Intergenic
1065016507 10:21467401-21467423 CGAGGATTCTTGGGGAGAAGAGG + Intergenic
1065467491 10:26040647-26040669 CAAGTATTCTTGGGGTAAATGGG + Intronic
1068553897 10:58436296-58436318 ACAGTGTTCTTGGGGCAAACGGG + Intergenic
1068593930 10:58881998-58882020 CAAGTATTCTTGGGGCAAATGGG + Intergenic
1072478086 10:95782849-95782871 TCAGGATTCTTGGGGATAATGGG + Intronic
1072557048 10:96526753-96526775 AGAGTATTCTTGGAGAAACCAGG - Intronic
1072597390 10:96887235-96887257 TGGGCATTCTTAGGTAAAACTGG - Intronic
1073030740 10:100523711-100523733 TGACTATTCCTGGGGAAATGAGG + Intronic
1073539238 10:104304932-104304954 TGAGTATTCTTCAGAAACACAGG - Intronic
1074179822 10:111049537-111049559 TGAGTATTCTTAGGACAAACAGG - Intergenic
1074513005 10:114136293-114136315 CGAGTATTCTCAGGGCAAACGGG - Intronic
1074707762 10:116150532-116150554 TGAATATTCTTGGGGCAGACAGG - Intronic
1079832658 11:25288311-25288333 TAAGTATTCTTGGGAAAACTGGG - Intergenic
1080612401 11:33915866-33915888 AGGGTATTCAAGGGGAAAACAGG - Intergenic
1081209339 11:40312606-40312628 TTAGCATTCTTGGGTAAAACTGG - Intronic
1081704625 11:45174040-45174062 TGGTTATTCTTGGGAATAACTGG - Intronic
1081777387 11:45684903-45684925 CGAGTCTCCTTGGGGAAAAGCGG + Intergenic
1082065627 11:47897566-47897588 TGAGTATTCTCGGGGCATATGGG + Intergenic
1083142230 11:60731460-60731482 CGAATATTCTTGGGGCAATCGGG - Intronic
1084878124 11:72149122-72149144 TGGGACTCCTTGGGGAAAACAGG + Intergenic
1085008452 11:73116940-73116962 TGATTTTTTTTGGGGAAAAATGG - Intronic
1085849928 11:80108287-80108309 TTAGTATTCTTGAGGAAGATAGG + Intergenic
1086268942 11:85036155-85036177 AGAGTATTCTTGTGGATATCAGG - Intronic
1087447441 11:98272625-98272647 TGACTATTTTTGGTGAAAATTGG + Intergenic
1088287201 11:108201279-108201301 AGAGGATTCTTGGGGATTACAGG + Intronic
1090165398 11:124541552-124541574 GGAATATTCTTTGGGAAAAAGGG - Intergenic
1090626919 11:128615952-128615974 GGAGTATTGTGGGGGAAAAATGG + Intergenic
1091625891 12:2120614-2120636 GGAATATTCTTTTGGAAAACAGG - Intronic
1091904463 12:4172954-4172976 TGGATATTTTTGTGGAAAACAGG + Intergenic
1091913398 12:4250264-4250286 TGAGTGTTCTTGGGGGCACCAGG + Intergenic
1092507942 12:9124173-9124195 AGAGGATTCTCGGGGCAAACGGG + Intergenic
1093158288 12:15714690-15714712 GCAGTATTCTTGGGGCAAATGGG + Intronic
1093554479 12:20454294-20454316 AGCGTATTCATGAGGAAAACTGG - Intronic
1095107475 12:38252582-38252604 CAAGTATTCTTGTGGCAAACAGG + Intergenic
1095467559 12:42503931-42503953 AGGGAATTCTTGGGGAAAAGTGG + Intronic
1095663769 12:44769984-44770006 AGAGTGGTCTTGGGGAAATCAGG + Intronic
1095671245 12:44862170-44862192 TGAGTATTCGTGGGGCAAATGGG - Intronic
1096042924 12:48535500-48535522 TGAGTATTCTCAGGGCAAACAGG + Intergenic
1097123820 12:56757173-56757195 CAAGTATTCTTGGGGCAAATGGG + Intronic
1097526549 12:60744568-60744590 TGAGTATTCTCAGGGCAAATGGG + Intergenic
1097778402 12:63674664-63674686 TGAGTATTTTTGGGGCAAACAGG + Intergenic
1099289278 12:80755187-80755209 CGAGTATTCTTGTGGCAAATGGG + Intergenic
1099803679 12:87489712-87489734 TAAGTATTCATGGGGAATGCTGG + Intergenic
1100247384 12:92773940-92773962 TGAGTATTTTGGGGGTAAAGGGG + Exonic
1101936358 12:109061173-109061195 GGAGTATTCTTGGGGCAAATGGG + Intronic
1103408933 12:120696790-120696812 TGAGGATACTTAGGGTAAACTGG + Exonic
1103617672 12:122165049-122165071 TGAGAATCTGTGGGGAAAACAGG + Intergenic
1103898284 12:124289076-124289098 TGTGTGTTCTTGGGGGAAGCTGG - Intronic
1104741035 12:131173912-131173934 TGAGTATTCTCAGGGGAAATGGG - Intergenic
1105468000 13:20665208-20665230 TGATTACTTTGGGGGAAAACTGG - Intronic
1107021668 13:35758651-35758673 TGAATATTCTCAGGGAAAATGGG + Intergenic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1107877697 13:44805186-44805208 TAAGTATTTTGGGGGAAAAATGG + Intergenic
1108322816 13:49303945-49303967 ACAGGACTCTTGGGGAAAACGGG - Intergenic
1109118706 13:58425877-58425899 TTAGTGTTCTTGGGCAAATCAGG + Intergenic
1109904265 13:68817455-68817477 CGAGTATTCTTGAGGCAAATGGG - Intergenic
1111606222 13:90542835-90542857 CAAGTATTCTTGGGTAAAATGGG - Intergenic
1111641028 13:90970414-90970436 TGAGTATTCTCGGGGCAAACAGG - Intergenic
1112048771 13:95624167-95624189 TGAGTCTTCTTTGGGGAAAACGG - Intronic
1112068955 13:95826672-95826694 TTATGATTCTTGAGGAAAACTGG + Intronic
1113507070 13:110824368-110824390 TGAGTATTCTTGGAGCAAATAGG - Intergenic
1113552288 13:111202011-111202033 TTAGTTTTCTGGTGGAAAACTGG + Intronic
1113673432 13:112191010-112191032 CGAGTATTATTGGGGCAAATGGG - Intergenic
1113705858 13:112432778-112432800 TGATTATTCTTGGGAAAAGGGGG - Intronic
1114788325 14:25626545-25626567 TGAGATTTCTGGGAGAAAACAGG - Intergenic
1115033198 14:28824002-28824024 TGAGTATTCTTGTGGCAAGGTGG + Intergenic
1115484263 14:33894670-33894692 TAAATAGTCCTGGGGAAAACTGG + Intergenic
1116089677 14:40289114-40289136 CAAGTATTCTTGGGGCAAATGGG - Intergenic
1116132860 14:40881044-40881066 TTAGTATTCTTGCTGAAATCAGG + Intergenic
1116934276 14:50722398-50722420 TTAATATTCTGGGGGAAAAAAGG - Intronic
1117404595 14:55389814-55389836 CGAGTATTCTTGGGGCAAATGGG + Intronic
1120455244 14:84721489-84721511 CAAGTATTCTTGGGGTAAATGGG + Intergenic
1120801417 14:88692598-88692620 TGGGTATCCTTGGGGAATCCTGG + Intronic
1121056417 14:90858602-90858624 CAAGTATTCTTGGGGCAAACAGG + Exonic
1121948574 14:98147832-98147854 TGCCTATTCTTGGGGAGACCAGG + Intergenic
1122173688 14:99900155-99900177 TTAATATTCTTGGGCAAAACAGG - Intronic
1122251225 14:100441335-100441357 TGAGCATTGTAGGGGAAGACTGG + Intronic
1202914930 14_GL000194v1_random:160041-160063 TCAGTGTGGTTGGGGAAAACAGG - Intergenic
1124403604 15:29373974-29373996 TGTGTATGCATGGGGAAAAATGG + Intronic
1126245800 15:46503651-46503673 CTAGTATTCTTGGGGCAAACGGG + Intergenic
1126378774 15:48024175-48024197 CGAGTATTCTTGGGGCAAACGGG - Intergenic
1127263445 15:57343013-57343035 TGAGTGTTCTTGGGGCAAACAGG + Intergenic
1127608496 15:60614482-60614504 TGTGTATTTTTGAGGAAAAGAGG + Intronic
1130721280 15:86387745-86387767 TGGGGATTCTTGGGGACAGCAGG - Intronic
1130772260 15:86936367-86936389 TCTATATTCTTGTGGAAAACTGG + Intronic
1131333999 15:91530006-91530028 ATAGTATTGTTGGGAAAAACAGG - Intergenic
1131823883 15:96300902-96300924 TAAGTATTCTTGGGACACACTGG - Intergenic
1133066310 16:3209701-3209723 TGGGTGTTCCTGGGGAAACCTGG - Intergenic
1133693846 16:8241981-8242003 TGTGTAATCTTTGGCAAAACAGG - Intergenic
1134233734 16:12449542-12449564 TCAGTAGTCTTGGGGTAACCTGG + Intronic
1136931861 16:34425437-34425459 TGAGTATTCTCAGGGCAAACAGG - Intergenic
1136972711 16:34986378-34986400 TGAGTATTCTCAGGGCAAACAGG + Intergenic
1140322313 16:73965058-73965080 TGTGTATTCAAGGGGAAAATTGG + Intergenic
1140779413 16:78281162-78281184 TAAGTATTCTTGGGGCAAATGGG + Intronic
1141990779 16:87608270-87608292 TGTGGAGGCTTGGGGAAAACAGG - Intronic
1143101632 17:4507735-4507757 TGACTGTGCTTGGGGAAAGCAGG + Intronic
1146503307 17:33382971-33382993 TGAGTTTTCTAGGTGAAGACAGG - Intronic
1146785684 17:35719124-35719146 TTATTATTAATGGGGAAAACTGG - Intronic
1147519527 17:41156992-41157014 TGAGGATTATTGGGAAAAAAAGG + Intergenic
1147781946 17:42949656-42949678 CGAGTATTCTCAGGGCAAACAGG - Intergenic
1149287335 17:55179234-55179256 TTAATACTCTTGGGGAAAAGTGG + Intergenic
1149569436 17:57661993-57662015 TTTGTATTGTTGGGGAAAGCAGG - Intronic
1150223245 17:63508946-63508968 TGGGTCTTCTTTGGCAAAACGGG - Intronic
1150960446 17:69906288-69906310 TGAGTATTTTTCTGGAAAACGGG - Intergenic
1151972114 17:77463359-77463381 TGAGTATTCTCGGGGCAAACAGG - Intronic
1152125436 17:78443864-78443886 TGAGTGTCCTTTGGGAAACCTGG + Intronic
1153046398 18:859154-859176 TGAGTATTCTGGGTGAATACAGG - Intergenic
1153526086 18:5995956-5995978 TGAGTATTCTCAGGGCAAACTGG - Intronic
1153673385 18:7434240-7434262 TGTGTAGTCTGGGGGAAAAATGG - Intergenic
1153804007 18:8696150-8696172 TGAGTATTGCTGGGGAAGAAAGG + Intergenic
1157769959 18:50337275-50337297 AGAGTGTTCTTAGGGAAACCTGG + Intergenic
1158573860 18:58619509-58619531 ACAGTATTCTCGGGGCAAACGGG - Intronic
1159150575 18:64518209-64518231 TGAGTATTCTCAGGGAAAATGGG + Intergenic
1159808674 18:72989147-72989169 CAAATATTCTTGGGGCAAACGGG + Intergenic
1159893811 18:73978111-73978133 GGAGTATCCTTGGAGAAATCTGG - Intergenic
1159960147 18:74549045-74549067 TGAGTATTCTTGGGGCAACCAGG - Intronic
1160182773 18:76649745-76649767 CGAGTATTCTTGGGGCAAATGGG + Intergenic
1161832093 19:6613593-6613615 AGAGTATTCTCGGGGCAAATGGG - Intergenic
1161872891 19:6884307-6884329 CTAGTATTCTTGGGGCCAACGGG + Intergenic
1163524567 19:17812802-17812824 TCTGAATTCTTGGGGAACACAGG - Exonic
1164015749 19:21254652-21254674 TGTGTATTCTTGCCAAAAACAGG - Intronic
1165117073 19:33535036-33535058 AGAGTTTTCATGGGGAATACTGG + Intergenic
1166831751 19:45643553-45643575 TGAGTATTCTGCGGGAAAAGGGG - Intronic
1167818189 19:51903009-51903031 TGAGTATTCTCAGGGCAAATGGG + Intronic
1168183698 19:54682701-54682723 CAAGTGTTCTTGGGGCAAACAGG - Intronic
925623931 2:5823411-5823433 CAAGTATTCTTGGGGCAAATGGG + Intergenic
927729422 2:25457578-25457600 TGAGTATTCTCGGGACAAATGGG - Intronic
928598006 2:32874909-32874931 CAAGTATTCTCGGGGCAAACGGG + Intergenic
928794117 2:34995895-34995917 AGAGTATTCTTGGGGCAAATGGG - Intergenic
929122964 2:38498582-38498604 TGTGTGTTCTTGGGGAAGAGTGG + Intergenic
929132943 2:38596173-38596195 TGAGTATTTTGGGGGAAAAGGGG - Intronic
930142525 2:47966835-47966857 CAAGTATTCTCGGGGCAAACAGG - Intergenic
930922386 2:56772424-56772446 TGTGTATTCTTGGACAGAACAGG + Intergenic
933157893 2:78994274-78994296 CTAGTATCTTTGGGGAAAACTGG - Intergenic
933630252 2:84647670-84647692 CGAGTACTCTTGGGGCAAATGGG - Intronic
940123701 2:150298061-150298083 TGAATATTCTTGGGGCAAAAGGG + Intergenic
940934074 2:159471256-159471278 TGAGCATTCTGGCAGAAAACAGG + Intronic
945256142 2:207804690-207804712 TGAGTATTCTCGGGGCAAGCGGG - Intergenic
946269004 2:218573813-218573835 TAAGCTTTCTTGGGGAAAAAAGG + Intronic
947456444 2:230258442-230258464 TGAGTATTCTTGGAGCAAAAGGG - Intronic
948576419 2:238954296-238954318 TGAATATTCTCAGTGAAAACAGG - Intergenic
948737598 2:240019355-240019377 TCAGTATTCTTGGGGCAAATTGG - Intronic
948987908 2:241536535-241536557 TGACTATTCTTGGGGCAAATGGG - Intergenic
1168731522 20:86338-86360 CGAGTATTCTGGGTGAAAATGGG - Intergenic
1168937222 20:1675662-1675684 AGAGTATTCTTGGAGCAAACAGG - Intergenic
1172204256 20:33151374-33151396 TTAGTCTCCTTGGGGAAACCTGG + Intergenic
1172531963 20:35637586-35637608 AGAAAATCCTTGGGGAAAACAGG - Intronic
1173406889 20:42774092-42774114 TGAATATTCTGGGGAAATACTGG + Intronic
1174988003 20:55477112-55477134 TGATTTTTGTTGGGCAAAACAGG - Intergenic
1175040808 20:56049020-56049042 TGAGTATTCTTGGGGCAAATGGG + Intergenic
1175476978 20:59283175-59283197 TAACTTTTCTTGGGGAAGACAGG + Intergenic
1176634278 21:9174686-9174708 TCAGTGTGGTTGGGGAAAACAGG - Intergenic
1177828717 21:26112724-26112746 AGAATATTCTGGGGGAAACCAGG - Intronic
1177897438 21:26871403-26871425 TGAGTATTCTCAGGGCAAATGGG + Intergenic
1178430983 21:32518707-32518729 TGAGTATTCTCAGGGCAAATGGG + Intergenic
1178710432 21:34911875-34911897 TGAGCAGCCATGGGGAAAACTGG - Intronic
1178721201 21:35011205-35011227 TGAGTATTCTTGGGACAAACAGG + Intronic
1179542210 21:42090482-42090504 TGAGTATTCCCGGGGCAAACAGG - Intronic
1181866836 22:25864793-25864815 TGTGTTTTCTTGGAGAAAAATGG + Intronic
1182138277 22:27928421-27928443 CAAGTATTCTTGGGGCAAATGGG + Intergenic
1183059211 22:35325431-35325453 AGAGTATTCTTGGGGCAAACGGG - Intronic
1183196215 22:36355375-36355397 AGAGTATTCTCTGGGAAAACAGG - Intronic
1183242943 22:36671915-36671937 GGTGTATTCTTGGGGATAAGAGG + Intronic
1185262522 22:49876644-49876666 TGAGTATTCTCAGGGCAAACAGG - Intronic
949153989 3:807127-807149 CGAATATTCTTGGGGAGAATGGG - Intergenic
951229718 3:20163709-20163731 TGAATATTCTTGGGGCAAACGGG + Intronic
951466613 3:23006892-23006914 TGAGAATTCTAGGGGAGAAGAGG + Intergenic
952299400 3:32090870-32090892 CAAGTATTCTTGGGGCAAACGGG + Intergenic
952880462 3:37982645-37982667 TAAGTATTCAGGGGGTAAACAGG + Exonic
955314874 3:57929483-57929505 TTTCTATTCTTGAGGAAAACTGG - Intergenic
956379631 3:68651932-68651954 CAAGTATTCTCGGGGCAAACGGG - Intergenic
960775268 3:121243583-121243605 TGAGTATTCTCGGGGCAAGTAGG - Intronic
960931019 3:122850455-122850477 CGAGTATTCTCAGGGCAAACAGG + Intronic
961046651 3:123713102-123713124 TGAGTGAACTTGGGGGAAACCGG + Intronic
961459342 3:127040317-127040339 TGAGCAGTCCTGGTGAAAACAGG + Intergenic
962036683 3:131659324-131659346 GGAAGATACTTGGGGAAAACTGG - Intronic
962676696 3:137763283-137763305 TGAGCATTCTTCGGGTAAAGAGG - Intergenic
963028775 3:140945757-140945779 TGAGCATTCTTAGGTTAAACTGG - Intronic
963838806 3:150083744-150083766 TGAGAATTCACTGGGAAAACTGG - Intergenic
964946552 3:162232488-162232510 TGACTTTTATTGAGGAAAACAGG + Intergenic
965011673 3:163101133-163101155 TGAGGATACTTGGGGAACACTGG + Intergenic
965294138 3:166921503-166921525 TGTGTATTTTCAGGGAAAACAGG - Intergenic
966088998 3:176107630-176107652 AGAGTTTTCTTGGGGAAAATAGG + Intergenic
966103089 3:176299356-176299378 TGATTTTTCATGGGGAAAAATGG + Intergenic
967605772 3:191444537-191444559 TGAGAATTTTTGGGGGAAAATGG - Intergenic
967755488 3:193163754-193163776 TTAGGATTCTTGGAGAAAGCAGG - Intergenic
971466371 4:26967343-26967365 AGAGTAGCCTTGGGGAAGACTGG + Intronic
972235107 4:37123003-37123025 TCAGTAGTCATGGGGAAAAGTGG - Intergenic
972715617 4:41643019-41643041 AGAATACTCTTGGGGAAGACAGG + Intronic
973930464 4:55788699-55788721 TAAGTGTTCTTGGGGAAAAGAGG - Intergenic
974160110 4:58127702-58127724 TTAATATTCTTAGGAAAAACTGG + Intergenic
974601801 4:64092869-64092891 AGAGGATTCTTGCTGAAAACAGG - Intergenic
976019859 4:80608820-80608842 TTAGAATTCTTGTGTAAAACTGG + Intronic
977949260 4:102951126-102951148 TGAGAATTCATAGGTAAAACTGG + Intronic
980264252 4:130494615-130494637 TGAGTATCCTTGGGCCAAATGGG - Intergenic
981154885 4:141423292-141423314 TAAGTATTCTTGGGGCAAATGGG - Intergenic
981793291 4:148564848-148564870 TTATCATTTTTGGGGAAAACTGG + Intergenic
982912122 4:161156083-161156105 CAAGTATTCTTGGGGCAAACAGG + Intergenic
983754008 4:171311226-171311248 TAAGTGGTGTTGGGGAAAACTGG - Intergenic
985113969 4:186573154-186573176 TGAGCATACTTTGGGAATACAGG - Intergenic
985479826 5:102510-102532 TGAGTATTCTCAGGGCAAATGGG + Intergenic
985888477 5:2698143-2698165 TGTCTCTTCTTGGGGAAGACTGG + Intergenic
986262747 5:6162699-6162721 TGAGTTGTCTTGGGCAACACAGG + Intergenic
986674925 5:10175703-10175725 TTAGTTTTCTTAGGAAAAACTGG - Intergenic
988176932 5:27740308-27740330 TCAGTATTCTTGGAGCAAACGGG - Intergenic
988813639 5:34809143-34809165 TGAGTATTCTTGGAGCAAATGGG - Intronic
989057161 5:37376769-37376791 AGAGTATTCTCAGGGAAAATGGG - Intergenic
989702036 5:44280038-44280060 GGAGTATTCTTGGAACAAACAGG + Intergenic
991770769 5:70038825-70038847 AGAGTATTCTTGGGGCAAACGGG + Intronic
991850063 5:70914242-70914264 AGAGTATTCTTGGGGCAAACGGG + Intronic
992327055 5:75670161-75670183 TGAGTATTCTCGGGGCCAATGGG - Intronic
993945761 5:94115595-94115617 TGAGTATTCTTAGGGCAAACAGG - Intergenic
995501865 5:112816036-112816058 TCAGTATTCTTGCAGAAAAGTGG - Intronic
997740268 5:136246929-136246951 CGAGTATTCTTGGGGCCAAGGGG - Intronic
998558659 5:143150306-143150328 TGTGAACTCTTGGGGAAGACAGG - Intronic
998905123 5:146896820-146896842 TTAGTATAATTGGGGAAAAGTGG + Intronic
999802784 5:155053349-155053371 TGATTATTTGTGGGGAAAGCAGG - Intergenic
1001712731 5:173791181-173791203 TGAGGAGTCTTGGGGAACAAAGG - Intergenic
1002004039 5:176217275-176217297 GGAGTGTTCTTAGGGAAACCTGG - Intergenic
1002222335 5:177693365-177693387 GGAGTGTTCTTAGGGAAACCTGG + Intergenic
1007211374 6:40195634-40195656 TGAGTGTTCTCGGGGGAGACTGG + Intergenic
1008241279 6:49115249-49115271 CGATTATTCTTGGGGCAAAAAGG - Intergenic
1008704155 6:54137549-54137571 GGAGTAGACTTGGTGAAAACAGG - Exonic
1008818652 6:55603630-55603652 AAGGTCTTCTTGGGGAAAACTGG + Intergenic
1010638220 6:78286519-78286541 TAAATATTCCTGGAGAAAACAGG - Intergenic
1010785637 6:79997096-79997118 CATGTATTCTTGGGGCAAACAGG - Intergenic
1010832328 6:80545905-80545927 TCAGTATTCTTGGGGAATTGAGG - Intergenic
1011492624 6:87907838-87907860 TGAGCATTCTTGGTGGTAACTGG - Intergenic
1013382648 6:109592331-109592353 TGAGTATTCTAGGGGCAAATAGG + Intronic
1014047718 6:116912568-116912590 TGAGGATTCCTGTGGAAATCAGG + Intronic
1014404804 6:121037860-121037882 TGAGTTTTGTTGGGAGAAACAGG + Intergenic
1014527424 6:122517582-122517604 TGAGTATTCTCAAGGCAAACAGG - Intronic
1014709645 6:124791767-124791789 TTTGTAGTCTTGGGTAAAACTGG - Intronic
1014783410 6:125590361-125590383 TGAGTATTCTTGGGACATACAGG - Intergenic
1015570286 6:134614156-134614178 TGACTATTCTTAGGGCAAACGGG + Intergenic
1016665855 6:146639306-146639328 TGAGTATTCTTGGGTGCAAATGG + Intronic
1017376160 6:153771309-153771331 TGAAATTTCTTGTGGAAAACAGG - Intergenic
1017467668 6:154709813-154709835 TGAGTATTCTCGGAGCAAACAGG + Intergenic
1018109874 6:160524984-160525006 ATAGTATTCTTGGGGCAAATGGG - Intergenic
1018702828 6:166440867-166440889 TGAGTATTCTTGGGGAAAACGGG + Intronic
1019097987 6:169601634-169601656 TGAGTATTCTTGGGGCGAATGGG + Intronic
1021779690 7:24090888-24090910 TGTGTATTATTGGGGGAAAATGG + Intergenic
1022937335 7:35192332-35192354 TGAGTATTTTTGGGGCAAACAGG + Intergenic
1023248716 7:38234780-38234802 TGAGTATTCTTGGGGCAAAAAGG - Intergenic
1025010008 7:55388953-55388975 GGAGTATCCTTAGGGAAACCTGG + Intronic
1026685984 7:72510584-72510606 GTAGTATTCTTGGGGCAGACGGG - Intergenic
1027996310 7:85429226-85429248 TGAGTATTCTTGGGGCAAACAGG - Intergenic
1028372790 7:90113268-90113290 TGAGTATTTTTGGGGCAAACAGG - Intergenic
1029833495 7:103284976-103284998 TGAGTATTTTTGGGGCAAACAGG + Intergenic
1030576753 7:111297096-111297118 TGAGGAATCTTTGGGATAACAGG + Intronic
1030956943 7:115864628-115864650 TTAGAATCCTTGGGGAAGACTGG - Intergenic
1031048846 7:116924609-116924631 TTAGTATTCTTTTGGGAAACAGG - Intergenic
1031218062 7:118923215-118923237 TGAGTATACTTGGGGTAAATGGG - Intergenic
1031314978 7:120245287-120245309 TGAATATTCTGGGGAAACACTGG - Intergenic
1031713944 7:125083724-125083746 TGAATATTCATGTGGAAAAAAGG - Intergenic
1031926832 7:127646771-127646793 TAAGTTTCCTTTGGGAAAACAGG - Intergenic
1033819602 7:145118307-145118329 AGAGTATTCTTGGGGCAAAAGGG + Intergenic
1033936692 7:146594030-146594052 TGAGGATTCTTGCTGAAGACAGG - Intronic
1035909537 8:3550284-3550306 TGGGAATTATTGGAGAAAACAGG - Intronic
1037212108 8:16402155-16402177 AGAATATTCTTGGGGCAAACGGG - Intronic
1038073074 8:24039401-24039423 TGAGCATTCATGGGGGAGACAGG + Intergenic
1038102281 8:24391201-24391223 AGAGTGATCTTAGGGAAAACAGG - Intronic
1039927922 8:41955298-41955320 TGAGTATTCTTGAGGATATGGGG + Exonic
1039954609 8:42197396-42197418 TGACTGTTCTTGGGGAAAACGGG + Intronic
1041021810 8:53645556-53645578 TGACTACTCTTGGGGACAGCTGG - Intergenic
1041963208 8:63644065-63644087 AGATTATTGTTGGAGAAAACTGG - Intergenic
1042721249 8:71828953-71828975 TGAATAGTCATGGTGAAAACAGG + Intronic
1043149987 8:76703733-76703755 TGTGTATTTTTTTGGAAAACAGG + Intronic
1043204517 8:77420383-77420405 GGAGTGTTCTTGGGAAATACAGG + Intergenic
1043728042 8:83637166-83637188 TCAGTTTTCTTTGGGAAATCAGG - Intergenic
1044526493 8:93258234-93258256 AGAGTGTTCTCTGGGAAAACTGG - Intergenic
1046482865 8:114845969-114845991 TGAGTATTCTTGTGCATAATAGG + Intergenic
1046530015 8:115432939-115432961 TGTGTATTCTTTGGTAAAAGTGG + Intronic
1047891955 8:129322477-129322499 TCAGTATTCTTGGAGCAAAACGG - Intergenic
1048519650 8:135141832-135141854 TGAGTTTTCAAAGGGAAAACAGG + Intergenic
1048719733 8:137310015-137310037 TGAGTTTTCTTGAGGAAATGGGG + Intergenic
1048753720 8:137710213-137710235 CGAGTATTGTTGGGGCAAATGGG - Intergenic
1048915200 8:139176051-139176073 TGAGCCTTCTTGGGGAGAAAAGG - Intergenic
1048921384 8:139234001-139234023 TGAGTATTCTTATGGAAATATGG + Intergenic
1049215377 8:141405403-141405425 TGGGTGGTCTTGGGGAAAACTGG - Intronic
1049524352 8:143114574-143114596 CAAGTATTCTTGGGGCAAACAGG + Intergenic
1050648736 9:7752059-7752081 CGAGTATTCTCGGGGCAAACAGG - Intergenic
1050815586 9:9807536-9807558 AGAGTATTCTTGGGGCATATGGG - Intronic
1051888538 9:21920058-21920080 AGAATATTCTTGGGGCAAACAGG + Intronic
1052118442 9:24677886-24677908 TGAGTCTTCTCAGGGAAGACTGG - Intergenic
1053584203 9:39438982-39439004 GCAGTATTCTTGGGGCAAATGGG - Intergenic
1054105783 9:60997728-60997750 GCAGTATTCTTGGGGCAAATGGG - Intergenic
1054739613 9:68791570-68791592 TGAGTCCTCTTGGGGAAAAAAGG + Intronic
1055046408 9:71930408-71930430 TAAGTATTTTGGGGAAAAACAGG - Intronic
1055581884 9:77714484-77714506 TTTGCATTCTTGAGGAAAACAGG + Intergenic
1055871306 9:80883813-80883835 TGGGTATTCTTGGGGCAAAAAGG + Intergenic
1056343826 9:85669548-85669570 TCAGTATCCTTAGGGAAAAATGG - Exonic
1057366764 9:94429741-94429763 CGAGTATTCTCGGTGCAAACAGG - Intronic
1057462585 9:95276829-95276851 CGAGTATTCTCTGGGCAAACGGG - Intronic
1057656571 9:96958323-96958345 TGAGTATTCTCGGTGCAAACAGG + Intronic
1058107718 9:100991971-100991993 GAAGTGTTCTTGGGGCAAACAGG + Intergenic
1058729309 9:107834864-107834886 TAAATTTTCTTGGGCAAAACAGG + Intergenic
1059065939 9:111083780-111083802 TGAGTCTTCATGAGGAAAGCTGG - Intergenic
1059265612 9:113027029-113027051 TGAGTATTCTTGGGGCAAATGGG + Intergenic
1060332056 9:122682055-122682077 AGTGTATTCTTGGGGCAAACAGG - Intergenic
1060861656 9:126959955-126959977 TGAGTGTTCTTGGGAAGAATGGG + Intronic
1185680689 X:1886451-1886473 TGAGTATTCTCGGGGCAAACAGG + Intergenic
1185888541 X:3803797-3803819 AGAGTATTCTCGGGGCAAATGGG + Intergenic
1185946962 X:4387562-4387584 TGAGTATTCTCAGCGCAAACAGG + Intergenic
1186319311 X:8407054-8407076 AGGTTACTCTTGGGGAAAACTGG + Intergenic
1187057142 X:15751775-15751797 ATATTATTCTTGGGGCAAACAGG - Intronic
1188839954 X:35004315-35004337 TGAATACTCTAAGGGAAAACTGG - Intergenic
1189108382 X:38260266-38260288 TGAGTCTTACTGGGGAAAGCAGG + Intronic
1189124311 X:38429764-38429786 TGAGAATAATTGGGAAAAACAGG + Intronic
1189189422 X:39086450-39086472 TGAGTATTCTCAGGGCAAATGGG - Intergenic
1191105460 X:56769410-56769432 TGAGTATTTTGGGGGAGAAGGGG + Intergenic
1191106453 X:56774812-56774834 TGAGTATTTTGGGGGAGAAGGGG + Intergenic
1191107446 X:56780214-56780236 TGAGTATTTTGGGGGAGAAGGGG + Intergenic
1192095853 X:68209861-68209883 TGATTATTCTTTTGGAAAAAAGG - Intronic
1193122035 X:77833538-77833560 TGAGTATTCTCAGGGCAAATGGG + Intronic
1194475578 X:94355937-94355959 TGCGTATTCTTGGGGCAAGCAGG + Intergenic
1195660760 X:107375662-107375684 TGAGTATTCTTGAAGAAATGTGG - Intergenic
1195677378 X:107517382-107517404 TGAGATTTCTTGGGGAAAATGGG + Intergenic
1195740233 X:108057874-108057896 TGAGTTTTCTTGGGGCTCACTGG - Intronic
1195911066 X:109889144-109889166 TGAGTTTTCTTGGGCCAAAAGGG + Intergenic
1198585541 X:138116675-138116697 TGATTATTCATCAGGAAAACAGG - Intergenic
1199077292 X:143537839-143537861 TGAGTATTCTTGGGGCAAAAGGG - Intergenic
1199324215 X:146477273-146477295 TGAGTATCCTTGGGGCCATCAGG - Intergenic
1200383894 X:155869479-155869501 AGAGTAAACTTGGGGAAAAGTGG - Intergenic
1201906426 Y:19090394-19090416 AGAGTATTCTTCGGGTAAATGGG - Intergenic