ID: 1018704975

View in Genome Browser
Species Human (GRCh38)
Location 6:166457417-166457439
Sequence TTTCTAAGGAAGCTGAGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 363}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018704972_1018704975 -8 Left 1018704972 6:166457402-166457424 CCAACACACAAATACTTTCTAAG 0: 1
1: 0
2: 1
3: 33
4: 298
Right 1018704975 6:166457417-166457439 TTTCTAAGGAAGCTGAGAATGGG 0: 1
1: 0
2: 4
3: 28
4: 363
1018704969_1018704975 -2 Left 1018704969 6:166457396-166457418 CCAACCCCAACACACAAATACTT 0: 1
1: 2
2: 6
3: 69
4: 637
Right 1018704975 6:166457417-166457439 TTTCTAAGGAAGCTGAGAATGGG 0: 1
1: 0
2: 4
3: 28
4: 363
1018704971_1018704975 -7 Left 1018704971 6:166457401-166457423 CCCAACACACAAATACTTTCTAA 0: 1
1: 0
2: 7
3: 49
4: 502
Right 1018704975 6:166457417-166457439 TTTCTAAGGAAGCTGAGAATGGG 0: 1
1: 0
2: 4
3: 28
4: 363
1018704970_1018704975 -6 Left 1018704970 6:166457400-166457422 CCCCAACACACAAATACTTTCTA 0: 1
1: 1
2: 6
3: 40
4: 490
Right 1018704975 6:166457417-166457439 TTTCTAAGGAAGCTGAGAATGGG 0: 1
1: 0
2: 4
3: 28
4: 363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018704975 Original CRISPR TTTCTAAGGAAGCTGAGAAT GGG Intronic
903600635 1:24536280-24536302 TTTCAAAGCAAGCTGAAAAATGG - Exonic
905497587 1:38405099-38405121 TGTTTAAGGAAGCTGAAGATAGG - Intergenic
906576976 1:46899867-46899889 CTTCTAATGAAGCTGGAAATAGG - Intergenic
906594990 1:47068039-47068061 CTTCTAATGAAGCTGGAAATAGG + Intronic
906663622 1:47601281-47601303 TGTCCAAAGAAGCTGAGATTAGG + Intergenic
907217276 1:52875087-52875109 ATTAGAAGGAAGCTGAGAGTGGG + Intronic
907860877 1:58351877-58351899 TTTCTAAGGACGGTGAGTCTAGG + Intronic
908610173 1:65849400-65849422 TTTCAGGGGAAGCTGAGAACAGG + Intronic
909109773 1:71460077-71460099 TTACTAAGTAAGCACAGAATTGG + Intronic
912591780 1:110829614-110829636 TGTCTAAAGAATCAGAGAATGGG - Intergenic
913024222 1:114819905-114819927 TTTCTATGAAAGCAGAGAAGAGG - Intergenic
916094938 1:161340720-161340742 TTTCAAAGGAGGCGGAGACTAGG - Intronic
916633742 1:166645223-166645245 TTTCTCAGGAAACTAAAAATAGG + Intergenic
916678638 1:167085115-167085137 TTTATAAGTCAGCTGGGAATGGG + Intronic
916744114 1:167671066-167671088 TTTATAAGAAAACGGAGAATAGG - Intronic
917393066 1:174560446-174560468 TAAATAAGTAAGCTGAGAATAGG + Intronic
918549795 1:185729251-185729273 TATCTAAGGAAACTGAGACTTGG - Intergenic
919099635 1:193078870-193078892 TTTCTTAGGAATTTTAGAATGGG - Intronic
919397748 1:197071428-197071450 TTTTTAAGGAGGCTGAAGATAGG - Intergenic
919520400 1:198581307-198581329 TGTTTAAGGAAGCTAAAAATAGG + Intergenic
919555550 1:199047807-199047829 TTTCTAACAATGCTGAAAATAGG - Intergenic
920104830 1:203544959-203544981 CTACTCAGGATGCTGAGAATTGG - Intergenic
920890618 1:209981768-209981790 TTTTCAAGAAAGCTGAAAATAGG + Intronic
924398579 1:243652016-243652038 TCTCTAAGGATGTTGAGTATTGG - Intronic
924399562 1:243664018-243664040 TTGCTAAGGATTCTGAGATTGGG - Intronic
1065370793 10:24983196-24983218 TTTATCAGGAAACTGAGATTTGG + Exonic
1066671748 10:37847813-37847835 TAACTGGGGAAGCTGAGAATGGG + Intronic
1069138191 10:64791438-64791460 TTTCCAGGAAAGCTGAGAACTGG - Intergenic
1069665391 10:70152408-70152430 TTCATGAGGAAGCTGTGAATAGG + Exonic
1070459847 10:76653938-76653960 TCTTTAAGGATGCTGAAAATAGG - Intergenic
1070546275 10:77455428-77455450 ATTCTGAGGAAGCCTAGAATGGG - Intronic
1070989426 10:80718468-80718490 GTTCCAAGCAAGCTGAGAAAGGG - Intergenic
1072868591 10:99091527-99091549 TTTTTAAGAAAACAGAGAATGGG - Intronic
1073167396 10:101468545-101468567 TATCTAAGGAAGCTGGAAGTGGG - Intronic
1073943260 10:108721773-108721795 TTTTTAAGGAGGCTAAAAATAGG - Intergenic
1074021693 10:109591113-109591135 TTTCTAAGGTCCCTGAGATTGGG - Intergenic
1074379048 10:112963694-112963716 TTACTTGGGAAGATGAGAATTGG + Intronic
1076343478 10:129765487-129765509 TTTCTGAGCCAGCTGAGAAATGG + Intronic
1078792819 11:14561652-14561674 TTTCTGATGCAGCTGAGACTAGG - Intronic
1079131237 11:17748047-17748069 CTGCTCAAGAAGCTGAGAATAGG + Intronic
1079746297 11:24135643-24135665 ATTCTAAGAATGCTGAGTATAGG + Intergenic
1081326523 11:41752539-41752561 TTTTTAAGGAGGCTAAAAATAGG + Intergenic
1081524235 11:43913914-43913936 TTTCCAGGGAAGCTGACAAGTGG - Intronic
1083285511 11:61656374-61656396 TTTCTAATGAAGAGAAGAATAGG + Intergenic
1084773718 11:71361391-71361413 TTTCTAAGGAAGAAGAAAAAAGG + Intergenic
1084898351 11:72292215-72292237 TCTTTCAGGAAGCAGAGAATGGG - Intergenic
1085887236 11:80535227-80535249 GTACTAGGGGAGCTGAGAATGGG + Intergenic
1086008371 11:82068001-82068023 TTTTTAAGGATGCTGAATATAGG + Intergenic
1087419537 11:97904075-97904097 TTTCTAAGGAAACTAACAAGTGG + Intergenic
1087705810 11:101490780-101490802 AATCTAAGAAAGCAGAGAATGGG + Intronic
1087936957 11:104045179-104045201 CTTCTAAACAAGCTGAAAATAGG + Intronic
1088426594 11:109711606-109711628 TTTTTAGGGAAGCTGACATTGGG - Intergenic
1089299088 11:117487730-117487752 TTTCAAAGCATGCTGAGAACTGG + Intronic
1090086004 11:123651759-123651781 TTTGCAAAGAAACTGAGAATGGG + Intronic
1091210301 11:133852775-133852797 TGTTTGAGGAAGCTGAAAATAGG + Intergenic
1091985307 12:4906329-4906351 TTTCTAGGGAAGCTGAGCTGAGG - Intergenic
1092310687 12:7348412-7348434 TTAATAAGGAAGAGGAGAATGGG + Intronic
1093212372 12:16323544-16323566 TTTGTAAGCAAACTGAGAACAGG - Intergenic
1093216642 12:16369427-16369449 TCTCTAAGGAATCTGGAAATTGG + Intronic
1094342298 12:29426291-29426313 TTTAAAAGGAAGCAGAGAAATGG + Intronic
1098452682 12:70637558-70637580 TTTCTAAGGAAACAGACAAAAGG - Intergenic
1098917064 12:76268553-76268575 TTTCAAAGGGACTTGAGAATAGG - Intergenic
1099467304 12:83003717-83003739 TCTTTAAGGATGCTGAAAATAGG + Intronic
1099713123 12:86254077-86254099 TTTAAAAGGAGGCAGAGAATAGG + Intronic
1099768591 12:87022629-87022651 TCTTTAAGAATGCTGAGAATAGG - Intergenic
1101049382 12:100845239-100845261 TTTTCAAAGAAGCTGTGAATGGG + Intronic
1102648262 12:114417984-114418006 GTTCGAAGCAAGCTGAGAGTGGG + Intergenic
1104582033 12:130017805-130017827 TTTCAAAAGAAGCTGGAAATGGG + Intergenic
1105202004 13:18189215-18189237 TCTTTAAGGATGCTGAAAATAGG + Intergenic
1105314603 13:19245651-19245673 TGTTTAAGGAAGCTGAAGATAGG - Intergenic
1105595882 13:21837466-21837488 TTTCTAGGGAAGTTGAGAAATGG + Intergenic
1109009537 13:56922711-56922733 TTACTAAGGACAATGAGAATGGG + Intergenic
1109207273 13:59496507-59496529 ATTCTAAGAAAGCTATGAATCGG - Intergenic
1109564849 13:64098801-64098823 TTTTAAGGGAAGCAGAGAATGGG - Intergenic
1110440732 13:75522548-75522570 TTTCTTAGTATGATGAGAATTGG + Intergenic
1112111078 13:96299759-96299781 TTTTGAAGGAAGGGGAGAATGGG + Intronic
1113846764 13:113396258-113396280 TTTCCAGGGAAGCTGAGAGAAGG - Intergenic
1114725110 14:24928137-24928159 TTCCTAAGGAAAGTGAGAAGAGG - Intronic
1115017163 14:28631914-28631936 TTTTTAAGGATGCTGAAAATTGG + Intergenic
1116134364 14:40901544-40901566 TTTCTAAGGACACTTAGAAATGG + Intergenic
1116295538 14:43102267-43102289 TTTTTAAGCAGGCTGAAAATAGG - Intergenic
1117056722 14:51919653-51919675 TTTGTAAGGCAGCTGAGCTTTGG + Intronic
1117890014 14:60410372-60410394 TTTCTAAGAATGCAGAAAATAGG + Intronic
1119163108 14:72469695-72469717 TTTCAAAGGTTGCTGAAAATCGG - Intronic
1121704806 14:95983590-95983612 ATTCAAAGGAATCTGAGGATAGG + Intergenic
1122536173 14:102464768-102464790 TGTCTGAGGAAGCTGACGATGGG + Intronic
1123055271 14:105566461-105566483 TTTCTAAAAATGCTGAAAATGGG - Intergenic
1123079720 14:105686305-105686327 TTTCTAAAAATGCTGAAAATGGG - Intergenic
1123572468 15:21628171-21628193 TTTCTAAGCAAGCTCAGAGAAGG + Intergenic
1123609084 15:22070758-22070780 TTTCTAAGCAAGCTCAGAGAAGG + Intergenic
1124429924 15:29598010-29598032 ATACTAAGGAGGCTGAGGATGGG + Intergenic
1125057685 15:35381905-35381927 CTTCTTAGAAAGCTGAAAATAGG + Exonic
1125139681 15:36390213-36390235 TGTCATAGGAAGCTGGGAATAGG - Intergenic
1125247920 15:37662834-37662856 TTTCTGAGGCAACTGTGAATGGG + Intergenic
1126058411 15:44754804-44754826 TTCCTAAAGGAGCTGAAAATTGG - Intronic
1126463984 15:48943906-48943928 CTTCCAGGGAAGCTGAGAAATGG + Intronic
1126464040 15:48944319-48944341 CTTCCAGGGAAGCTGAGAAATGG - Intronic
1126757829 15:51941507-51941529 TGTCTAAGAAAGCTGAGGGTTGG + Intronic
1127808659 15:62544159-62544181 TTTTTAAGGAATCTGAAATTTGG - Intronic
1128027857 15:64453669-64453691 TTTCTGAGGAAGCCCAGAAAAGG + Intronic
1129003490 15:72353208-72353230 TTTCAAAGGAAGCTTACTATGGG + Intronic
1130779734 15:87022797-87022819 TGTTTGAGGAAGCTGAAAATAGG - Intronic
1131326678 15:91454822-91454844 TGTTTAAGGAAGCTGAAGATAGG + Intergenic
1131870863 15:96763165-96763187 TTTCTAAAGAAACTGAGGCTCGG - Intergenic
1202981325 15_KI270727v1_random:362558-362580 TTTCTAAGCAAGCTCAGAGAAGG + Intergenic
1135883070 16:26278215-26278237 TTTTTAAGGAGGCTAAAAATAGG + Intergenic
1136554376 16:30999108-30999130 CTGATAAGGAAGCTGAGAGTAGG + Intronic
1137999863 16:53265983-53266005 TTTTTAAGGAAACTGGGAAGGGG + Intronic
1138108853 16:54307347-54307369 CCTCTAAGGGAGCTGAGACTGGG + Intergenic
1139836293 16:69841348-69841370 TCTCTGAGGAAGCTGAGACTTGG + Intronic
1140865525 16:79057709-79057731 ATTCTGAGGGAGCTCAGAATAGG + Intronic
1140917353 16:79506283-79506305 ATGCTAAGGAAGCTGAGGCTCGG + Intergenic
1141361315 16:83397492-83397514 TCTGTAAGGAAGATGAGCATGGG + Intronic
1142606680 17:1085483-1085505 TAACTAATAAAGCTGAGAATAGG + Intronic
1142788101 17:2241148-2241170 TTTCTTAGGAAGGTGAAATTGGG + Intronic
1143246639 17:5491973-5491995 ATTCCAGGGAAGCAGAGAATGGG - Intergenic
1144369577 17:14577248-14577270 TTTTTAAGTGAGCTGAGAAAGGG + Intergenic
1145072766 17:19824967-19824989 TTACTAATGTAGCTGAGATTTGG - Intronic
1147359276 17:39921105-39921127 TTTCTAAGCAAAGTGTGAATAGG - Intronic
1150230825 17:63549594-63549616 TTTTGATGAAAGCTGAGAATTGG + Intergenic
1150765211 17:67996727-67996749 TTACTAAGGAAGCAGTGACTTGG - Intergenic
1150980867 17:70139980-70140002 TAGCTAAGGAAACTGAGAATTGG - Intergenic
1151787346 17:76281495-76281517 TTTCTAGGGAAATTGAGAAGGGG + Intronic
1152872097 17:82760789-82760811 TTACTGCGGAAGCAGAGAATGGG - Intronic
1155670438 18:28364329-28364351 TATCTTATGAAGCTGAAAATAGG + Intergenic
1155883416 18:31178512-31178534 TTTCTAAGGTAAAAGAGAATTGG - Intergenic
1156128827 18:33942472-33942494 TTTCTAAGGCATCTGTGTATTGG - Intronic
1157787160 18:50494335-50494357 TTTCTAAGGAAGCATGAAATGGG + Intergenic
1157834510 18:50887486-50887508 TATTTTGGGAAGCTGAGAATGGG + Intronic
1159453879 18:68637219-68637241 TTTTTAAGGAGGCTGAAGATAGG + Intergenic
1160087901 18:75796356-75796378 TTTCAAAGGCATCTGAGATTGGG - Intergenic
1161186085 19:2921669-2921691 TTTCTCAGGAGGCTGAGGCTAGG + Intergenic
1162494699 19:11017199-11017221 TGTCCACGGAAGCTGAGAATGGG - Intronic
1164191762 19:22924496-22924518 TTTCTCAGGCAGCAGAGAAGAGG - Intergenic
1166262909 19:41654285-41654307 TTTTTAAGGAGGCTGAAGATAGG - Intronic
1167413855 19:49360447-49360469 TTTCTTGGAAAGCTGAGGATGGG + Intronic
1168126734 19:54288123-54288145 TTTCCCAGGAAAATGAGAATGGG + Intergenic
1168282696 19:55313907-55313929 TTTCTAAGGGGGCTGAGAAGTGG + Intronic
925274967 2:2642130-2642152 CTCCCAAGGAAGCTGAGAACAGG - Intergenic
925495368 2:4442595-4442617 TGTCTAAGGAAGCTAAAATTGGG + Intergenic
925910070 2:8568045-8568067 TTGCTAAGGAAGCTCAGAGAGGG + Intergenic
926370496 2:12173966-12173988 ATTCTAAAGGAGCTGAGAAAGGG - Intergenic
926479926 2:13379152-13379174 TCTTTAAGGATGCTGAAAATAGG - Intergenic
926556041 2:14359212-14359234 TGTTTAAGGAAGCTAAAAATTGG - Intergenic
926948795 2:18218618-18218640 TTTCATGGGAAGCTGAGAATTGG - Intronic
927176566 2:20413679-20413701 TGTTTAAGGAAGCTAAAAATAGG + Intergenic
927506701 2:23619665-23619687 TTTCTAATCAAGCTGTTAATAGG - Intronic
927535409 2:23853679-23853701 TTTCTAAAGAAACTGACAAGAGG + Intronic
928724802 2:34160037-34160059 TTTGGAGGGAAGCTGAGGATTGG + Intergenic
928943141 2:36748026-36748048 TCTTTAAGGGTGCTGAGAATAGG + Intronic
929044024 2:37773368-37773390 ATTCTGAGGGAGCTTAGAATAGG + Intergenic
931009968 2:57899519-57899541 TTTCTAAGCAAGATGAAAAAGGG + Intergenic
932145997 2:69317805-69317827 TTTATAAGGAAGAGGAAAATGGG + Intergenic
932856847 2:75242928-75242950 TCTTTAAGGATGCTGAAAATAGG - Intergenic
933363795 2:81323190-81323212 TCTTTAAGAAAGCTGAAAATAGG + Intergenic
935265508 2:101390217-101390239 CTTCTCAGGAGGCTGAGGATGGG - Intergenic
935325165 2:101929184-101929206 ATTCTGAGGAAGCTGAGTGTTGG + Intergenic
936509892 2:113136976-113136998 TTTTGAAGGAAGCTTAGAAGAGG + Intergenic
936998373 2:118438882-118438904 TTTTCAAGGAAGCTGAGGAAGGG - Intergenic
937572617 2:123382365-123382387 TGTTTAAGGAAGCTGAAGATAGG - Intergenic
937604475 2:123781024-123781046 ATTCTACGGAAGCTCAGAAATGG + Intergenic
937781808 2:125847477-125847499 TGTTTAAGGAGGCTGAAAATAGG + Intergenic
937828794 2:126398001-126398023 TGTTTAAGGAAGCTGAAGATAGG + Intergenic
938169213 2:129059853-129059875 TTTCACAGGCAGCTGAGAAAGGG - Intergenic
938772928 2:134516128-134516150 CTTCTAAGGAAACTGAGCCTTGG - Intronic
939902682 2:147869170-147869192 TTTCTAAGGAATATGAAAGTAGG - Intronic
940329073 2:152455130-152455152 TTCCTACAGAAGCTGAGAAGGGG + Intronic
941896765 2:170637045-170637067 TTGCTAACAAAGCTGAGAAATGG - Intronic
942276822 2:174328976-174328998 TTTCTTAGGAAGCGGAGAGAGGG + Intergenic
944265459 2:197720161-197720183 TTGCTCAAGAAACTGAGAATAGG + Intronic
944663214 2:201938328-201938350 TCTCTAAGGAGGCTGGGACTTGG - Intergenic
945005096 2:205396762-205396784 TTTCTAAGGTAACAGATAATGGG + Intronic
945463386 2:210138552-210138574 TGTCTAAGGAAGCTTAACATTGG + Intronic
946173079 2:217906843-217906865 TTTCTGAGCTAGCTGAGAGTTGG - Intronic
948812237 2:240486077-240486099 ATTCTAAAGAAGCTGAGAGAAGG + Intronic
1169782521 20:9324525-9324547 TTTCTTAGGGAAATGAGAATGGG - Intronic
1170901766 20:20470226-20470248 TTTCTAATTAAGCTAAGGATGGG - Intronic
1173270386 20:41529012-41529034 TTGCTAAGGAAGATCAGAAATGG - Intronic
1175640117 20:60622031-60622053 TTTCTCAGGAAGCTGAGAAATGG + Intergenic
1176136644 20:63525576-63525598 TTTATAAGGAATCTGAGATTGGG - Intergenic
1176715947 21:10348791-10348813 TCTTTAAGGATGCTGAAAATAGG - Intergenic
1177140746 21:17354966-17354988 TTTTTGAGGAAGCTTAAAATAGG - Intergenic
1177683894 21:24411521-24411543 CTTCAAAGGAAACTGAGACTTGG - Intergenic
1179927764 21:44547375-44547397 TTCCTGAGGAAGCCCAGAATTGG - Intronic
1179938309 21:44619506-44619528 TTCCTGAGGAAGCCCAGAATTGG + Intronic
1180602392 22:17031162-17031184 TCTTTAAGGATGCTGAAAATAGG + Intergenic
1180725137 22:17941387-17941409 CTTCCAGAGAAGCTGAGAATGGG - Intronic
1181866084 22:25856540-25856562 TTTCCAAGGGAGGTGAGAGTGGG + Intronic
1182265553 22:29112239-29112261 TTTCTTAGGAAGCTGGAATTGGG - Intronic
1182536633 22:31008544-31008566 CTACTCAGGAGGCTGAGAATTGG + Intergenic
1182693713 22:32181734-32181756 TTACTATGGATGCTGAGAAAAGG - Intergenic
1183610547 22:38901074-38901096 TTTCTAAGCAAGCACATAATCGG - Intergenic
1183985144 22:41565651-41565673 CTTTTAGGGGAGCTGAGAATTGG + Intronic
949120641 3:379608-379630 TTTGTAAGGAAATTGAGAAGGGG - Intronic
949635745 3:5979909-5979931 TTTCTAAGCAAGCTGAGCTCAGG + Intergenic
951060392 3:18200146-18200168 TCTTTAAGGATGCTGAAAATGGG + Intronic
951268296 3:20596258-20596280 TGTTTAAGGAAGCTGAAGATAGG + Intergenic
953631069 3:44618244-44618266 TTTCTAAGGAAATTCTGAATTGG + Intronic
953902193 3:46849697-46849719 TTGCTAAGGAAGCTCTGCATGGG - Intergenic
956118481 3:65942080-65942102 TTTCTAAGAAAGCTAAGGCTGGG - Intronic
956817231 3:72919076-72919098 TTTCTTAGGAAGCTGAATATAGG + Intronic
957140908 3:76355419-76355441 TGGCTGAGGAAGCTGAGACTTGG + Intronic
957254858 3:77824143-77824165 TCTTTAAGGATGCTGAAAATAGG + Intergenic
957592835 3:82223536-82223558 TCTTTAAGGATGCTGAAAATAGG + Intergenic
957617301 3:82547226-82547248 TTTTTAAGGGAGCTGAGCAAGGG + Intergenic
957997283 3:87706498-87706520 TTTCTAATTAAGGTGAGAGTGGG - Intergenic
958530881 3:95329165-95329187 CTTCCATGGAAGCTCAGAATGGG - Intergenic
960060849 3:113318765-113318787 TTTATAAGGACACTGAAAATAGG - Intronic
961195506 3:124998219-124998241 GTTCTTAGGAAGCCGAGACTTGG + Intronic
962034602 3:131637874-131637896 TCTTTAAGGAGGCTAAGAATAGG - Intronic
962244627 3:133782236-133782258 TTTCTAAATAAACTGAAAATAGG + Intergenic
962392999 3:134989040-134989062 TTTTTAAGGGAGCTAAGAATTGG + Intronic
962474994 3:135747688-135747710 TCTCTAAGAAAGGTGAAAATGGG + Intergenic
963009677 3:140757536-140757558 TATCAAAAGAAGCTGAGAACAGG + Intergenic
963170423 3:142244581-142244603 TTGCTATGGTAGCTGAGACTGGG - Intergenic
963368797 3:144370771-144370793 TTTTTAAGGATGTTGATAATAGG - Intergenic
964459350 3:156905711-156905733 CTTTTAAGGAAGCAGGGAATGGG - Intronic
964644000 3:158938311-158938333 TGTTTAAGGAGGCTGAAAATAGG - Intergenic
966233409 3:177673746-177673768 TTTATAAGGAAGCTAAAATTTGG - Intergenic
966434949 3:179872719-179872741 TTTCTAAAGCAGGTGAGACTTGG - Intronic
969468763 4:7373867-7373889 GTTCTAAGGATGCTAAGAAATGG - Intronic
971430984 4:26567194-26567216 TTAATAAGGAAACTGAAAATCGG + Intergenic
971512227 4:27440983-27441005 TTTCTCAAGAAGATGAAAATTGG + Intergenic
972363638 4:38352270-38352292 TCTTTAAGGAAGCTGAATATAGG - Intergenic
972938853 4:44172265-44172287 TTTGGAAGGAAGCTTAGAGTGGG - Intergenic
973070680 4:45854946-45854968 TGTTTAGGGAAGCTGAAAATAGG + Intergenic
974091395 4:57315063-57315085 AGGCTAAGGAAGCTGAGAAGTGG - Intergenic
974521139 4:62981066-62981088 TTTCTAAGGAAGCTACACATAGG - Intergenic
974675870 4:65088741-65088763 TCTATAAGAATGCTGAGAATTGG + Intergenic
974972367 4:68845730-68845752 GTTCCAAGGAAGCTGAGACGGGG + Intergenic
975350973 4:73345995-73346017 TTTCTAAAGTACCTAAGAATTGG + Intergenic
975534753 4:75437272-75437294 TGTTTAAGGAAGCTAACAATAGG - Intergenic
975790362 4:77943181-77943203 TTTTTAAGGAGGCTGAAGATGGG + Intronic
976569611 4:86593813-86593835 TTTGAAAGGAAGAGGAGAATGGG - Intronic
977599803 4:98923924-98923946 TTTCTAAGTCAGCTGAAAGTCGG - Intronic
977758224 4:100699282-100699304 TTACTAAGGAAGTTGAGTGTAGG + Intronic
977830363 4:101583779-101583801 TTAATAAGAAAGCTGAGAATTGG - Intronic
978165866 4:105605844-105605866 TTAGTAAGGAAGTTGAGAAGAGG - Intronic
979368767 4:119857753-119857775 TTTCTAAGGAAGTAGTAAATTGG + Intergenic
979408369 4:120342673-120342695 TTCATGAGGAAGCTGTGAATAGG - Intergenic
979461765 4:120991924-120991946 TGTTTAAGGAAGCTAAAAATAGG + Intergenic
980822952 4:138040003-138040025 TTCCTCAGGAAACTGAGCATAGG + Intergenic
981167854 4:141582885-141582907 TTTCTAAGGAAGCTAAAAATAGG - Intergenic
981437831 4:144747155-144747177 TTTCTAAGGCAGTGGAGAAGTGG + Intergenic
982333517 4:154208769-154208791 ATTCTAAGGAACCTGAGAGGAGG - Intergenic
982991963 4:162287545-162287567 TGTTTAAGGAAGCTAAAAATAGG - Intergenic
983714116 4:170755834-170755856 TTTTTAAGAATGCTGAAAATAGG + Intergenic
986139305 5:5015097-5015119 TTCCTAAAGAAGCTGTGAATTGG + Intergenic
987583168 5:19821801-19821823 TCTTTAAGGATGCTGAAAATAGG - Intronic
987759416 5:22141077-22141099 TTAATAAGGAAGCAGAGAGTTGG - Intronic
989168627 5:38453972-38453994 TTTCTCAGGATTCTGAAAATTGG + Intronic
989230178 5:39075593-39075615 TTTTAAAGTAAGCAGAGAATTGG - Intergenic
989461715 5:41707277-41707299 TCTCTAAGGATGCTGAATATAGG + Intergenic
990243705 5:53840579-53840601 TGTTTAAGGAAGCTGAAGATTGG - Intergenic
990747131 5:58969832-58969854 TTTCTAAGCAAGCTTTGAAAGGG - Exonic
991150988 5:63369782-63369804 TTTCTAACACAGCTGAGAAAAGG + Intergenic
991366469 5:65873189-65873211 TTTCTAAGTATGATGAGAAGCGG - Intergenic
991894139 5:71374507-71374529 TTAGTAAGGAAGCAGAGAGTTGG - Intergenic
992281540 5:75182416-75182438 TTCCTAAAGAAGATGAAAATGGG + Intronic
992465963 5:77004853-77004875 TTTCCAAGGAAGCTTATAATAGG + Intergenic
993997334 5:94738414-94738436 TTGTTAAGGAAGTTCAGAATTGG - Intronic
994744856 5:103665602-103665624 CTTCAAAGGAAGCTGGAAATTGG + Intergenic
994833564 5:104818202-104818224 TTTCTAAGGGAGCTGAGAAGAGG + Intergenic
995329104 5:110926758-110926780 TATTTAAGGAAGCTATGAATAGG + Intergenic
996451720 5:123633093-123633115 TTTCTGAGGCAATTGAGAATGGG - Intergenic
997258088 5:132444445-132444467 TTTCTCAGGGACATGAGAATTGG + Intronic
998095415 5:139393462-139393484 TTACTCAGGAAGCTCAGAATGGG - Exonic
998742195 5:145216838-145216860 TTTCTCAGAAATCAGAGAATAGG + Intergenic
999353422 5:150900421-150900443 TTTCTAAGGAAGTAGGTAATAGG - Intronic
999848168 5:155508001-155508023 TTTCCAAGGAAGATGAGAGAGGG - Intergenic
1000770229 5:165343884-165343906 TTTCTGAGGAAGCTGAGAGAGGG - Intergenic
1000873932 5:166612066-166612088 TTTATAGGGAATCTGTGAATGGG - Intergenic
1001114573 5:168928812-168928834 TCTGGAAGGAAGCTGAGAAGTGG + Intronic
1001860709 5:175052370-175052392 TTTCTCAGGGAGGAGAGAATGGG - Intergenic
1002308975 5:178302811-178302833 GTTCTAAGCAAGCTGTGCATAGG + Intronic
1002759108 6:188178-188200 TTTCTAAGGATGCAGATATTGGG - Intergenic
1002952731 6:1831335-1831357 TTACTAAAGAAACTGAGAAATGG - Intronic
1003106341 6:3219334-3219356 TCTGTTAGGAAGCAGAGAATGGG - Intergenic
1003204655 6:3996476-3996498 TTTCTCAGGAAGAAGAGAAATGG + Intergenic
1003965604 6:11249621-11249643 TGACTAAGGAAGAGGAGAATGGG + Intronic
1004120630 6:12818218-12818240 TTTCTCAGGAATCTGTGACTTGG + Intronic
1004440312 6:15643627-15643649 TTTTTAAGGAGGCTAAAAATAGG - Intronic
1005151548 6:22757303-22757325 TTTCTAAAGAAGGAGAGAATGGG + Intergenic
1005835576 6:29706236-29706258 TTTTTAAAGAAGCTGAACATTGG + Intergenic
1008554693 6:52663586-52663608 TCTCTAATGAAGCTGAAAAGAGG + Intergenic
1008930840 6:56938243-56938265 TTACTCAGGAAGCTGAGATAAGG - Intronic
1009195317 6:60677726-60677748 ATTCAAAGGTAGCTGAAAATGGG + Intergenic
1009305666 6:62086673-62086695 TGTCTGACAAAGCTGAGAATAGG + Intronic
1009324244 6:62330245-62330267 TTTCTAGGAAAGCTGATATTTGG + Intergenic
1009558358 6:65204388-65204410 TTTTTAAGGAGGCTAAAAATAGG - Intronic
1010743377 6:79533846-79533868 TATCTAAAGAAGCTGAGCACAGG - Intronic
1010773103 6:79855209-79855231 TTTCTACAGAATCTGAGATTTGG + Intergenic
1010987436 6:82440885-82440907 TTTACAAGGAGGCTGAGATTTGG + Intergenic
1011636017 6:89374192-89374214 TTTCTAAGGAAACTGAGGCTAGG + Intronic
1012221962 6:96659355-96659377 TCTCTAAGGACACTGAAAATAGG - Intergenic
1012930586 6:105311903-105311925 TTTCTAAGGATTCTGAGCAATGG + Intronic
1013115478 6:107100560-107100582 TTTCTAATGAAGCTTAGGCTGGG - Intronic
1013995782 6:116306008-116306030 TTTCTAAACTAGTTGAGAATGGG - Intronic
1014883308 6:126748625-126748647 TTTGTAAGGCAGCAGAGAACAGG - Intergenic
1016491584 6:144610507-144610529 TTTCTAGAAAAGCTTAGAATTGG - Intronic
1016550509 6:145274531-145274553 TATCTGAGGAAGCTGAGGCTTGG - Intergenic
1017549286 6:155488055-155488077 CTTGTAAGAAAACTGAGAATTGG - Intergenic
1018704975 6:166457417-166457439 TTTCTAAGGAAGCTGAGAATGGG + Intronic
1019123240 6:169822110-169822132 TGTTTAAGGAGGCTGAAAATAGG + Intergenic
1020574331 7:9906371-9906393 TTTATGAGGTACCTGAGAATTGG + Intergenic
1021083817 7:16395827-16395849 TTTCAAAGGAAGTTGGGAAAAGG - Intronic
1022388612 7:29924530-29924552 TTTGCAAGGAAGCTGAAGATGGG - Intronic
1023318997 7:38973563-38973585 TTTCTAGGGAAGTTGAGGACAGG - Intergenic
1023435723 7:40138633-40138655 TTGGTGAGGAAGCTGAGAAAAGG - Intronic
1023669062 7:42556990-42557012 TTTAAAGGGAAGCAGAGAATTGG + Intergenic
1024603206 7:51004715-51004737 TTCCAAAGGTAACTGAGAATGGG - Intergenic
1024963136 7:54998766-54998788 TTTCTTAGGAAACAGAGAAGAGG - Intergenic
1027631712 7:80614658-80614680 TTTCCAAGGAAGGGCAGAATCGG - Intronic
1028240002 7:88408328-88408350 TTTTCAAGGAAGCTGAAGATTGG + Intergenic
1028268837 7:88761468-88761490 TTTCTAAAGATTCTCAGAATTGG + Intronic
1028304723 7:89248447-89248469 TTTCAAAGAATGCTGAAAATAGG - Intronic
1028370721 7:90088711-90088733 TCTTTAAGGATGCTGACAATAGG - Intergenic
1029351737 7:100017904-100017926 CTTCTAAGCAGGCTGAAAATTGG + Intronic
1029828925 7:103234263-103234285 TTTCTAAGGAAGCTATGTTTGGG + Intergenic
1030968814 7:116027647-116027669 CATCTAAGGAAGCTGAGCATTGG + Intronic
1031147965 7:118017976-118017998 TGTTTAAGGAAGCTGAAGATAGG - Intergenic
1031998367 7:128247632-128247654 TTGATAAGGGACCTGAGAATGGG - Intronic
1032564365 7:132926349-132926371 TTTCTGAAGAAGCTGACAGTGGG + Intronic
1032652730 7:133896316-133896338 TCTCTAAGAAAGCTAATAATGGG + Intronic
1033258105 7:139819148-139819170 TTGCAAAGGAGGCTGAGAAATGG - Intronic
1034010133 7:147520839-147520861 GGTCTACGGAAGCTGAGCATGGG - Intronic
1034161369 7:148996309-148996331 CTTTTAAGGAAACTGAGAATTGG - Intergenic
1035101492 7:156401297-156401319 TTTCTAGTGAAACTGAGAAGAGG + Intergenic
1035347907 7:158218280-158218302 TCTTTAAGGATGCTGAAAATAGG - Intronic
1035925681 8:3725410-3725432 TTTAAAAGGAAGCAGAGATTTGG + Intronic
1037328299 8:17717263-17717285 GTTCTAGGGAAGGTGAGAATTGG - Intronic
1038835607 8:31118145-31118167 GTTTTAATGAAGCTGTGAATTGG - Intronic
1039641649 8:39229020-39229042 TGTCTGAGGAAGCTGAAGATAGG - Intronic
1039911020 8:41827025-41827047 TTTCTAATGACTTTGAGAATTGG + Intronic
1041119814 8:54574621-54574643 TGTCTAAGAAATCTGGGAATAGG + Intergenic
1041267626 8:56080493-56080515 TTTATGAGGAAGCTGAGGTTAGG + Intergenic
1041560580 8:59213892-59213914 TCTCTAAAGATGCTGAAAATAGG + Intergenic
1041887805 8:62832057-62832079 TCTCTAAGAATGCTGAAAATAGG - Intronic
1043062619 8:75524365-75524387 TTTCTAAGGAAGATGAGCTTGGG - Intronic
1043288214 8:78561907-78561929 GTTAGAAGGGAGCTGAGAATGGG - Intronic
1044010824 8:86992768-86992790 TCTTTAAGGATGCTGAAAATAGG + Intronic
1044768181 8:95599291-95599313 TCTTTAAGGATGCTGAAAATAGG - Intergenic
1044982362 8:97729464-97729486 TCTGTTAGGAAGATGAGAATTGG + Intergenic
1045173419 8:99695833-99695855 TGTCTGAGGAAGGTGAGAAGGGG + Intronic
1045245622 8:100439461-100439483 TTTCTAAGGGAGGTGAGGAGGGG + Intergenic
1047659478 8:127017308-127017330 CTTCTCAGAATGCTGAGAATGGG - Intergenic
1047673437 8:127173491-127173513 TTGATAAGAAAACTGAGAATTGG - Intergenic
1047887415 8:129267127-129267149 CTTCCAAGAATGCTGAGAATAGG + Intergenic
1048614791 8:136061090-136061112 TATTTAAGGATGCTGAAAATAGG - Intergenic
1049090479 8:140510705-140510727 TTTCTAAGGAAAATGGGAAGTGG - Intergenic
1049195443 8:141313212-141313234 TCTCTAAGGAAGCTGGGCAGGGG - Intergenic
1050684264 9:8149133-8149155 TTTCTAAGGATGCTGAATGTAGG - Intergenic
1050912284 9:11086888-11086910 TTTAAAAGCAAGCTGAGAGTCGG - Intergenic
1052493481 9:29195494-29195516 TTTCTAAGGAAGTTAATAATGGG - Intergenic
1054970974 9:71086390-71086412 TTTTTAAGGTTGCTGAGAAGAGG - Intronic
1055207429 9:73749966-73749988 TCTTTAAGGATGCTGAAAATAGG + Intergenic
1057870986 9:98717227-98717249 TTACTATGGATGCTGAGAAAAGG - Intergenic
1058221406 9:102308428-102308450 TTTTTAAGGATGCTGAAAATAGG + Intergenic
1058244437 9:102605157-102605179 TTTTTATGGAAACTGTGAATGGG - Intergenic
1058570046 9:106331769-106331791 TTTATGAGGAAACTGAGAGTTGG - Intergenic
1060312155 9:122471788-122471810 TTACTAAAGAAGCACAGAATTGG + Intergenic
1061527194 9:131175774-131175796 GTTCTAAGAAAGCAGAGACTAGG + Intronic
1062682742 9:137791016-137791038 TTTCTCAGAAAGCTGAGCAAGGG + Intronic
1186690232 X:11967774-11967796 TTTTTAAGGAAGCTGACCAGTGG + Intergenic
1187626051 X:21115147-21115169 TCTCTCAGGAAGCTCAGACTTGG + Intergenic
1187748546 X:22434940-22434962 TGTTTGAGGAAGCTGAAAATAGG - Intergenic
1188102125 X:26101717-26101739 TTTAAAAGGAAGAGGAGAATGGG - Intergenic
1188534493 X:31181473-31181495 TAGCTAAGGAAGCAGAGAAAAGG + Intronic
1188588513 X:31805356-31805378 TTTCAAAGAAAGCTGAGATGTGG + Intronic
1189567368 X:42256511-42256533 TGTTTAAGGAGGCTGAAAATAGG - Intergenic
1192202223 X:69073679-69073701 TTTCTAAGGAAACTGAGGTAAGG + Intergenic
1193078120 X:77376674-77376696 TGTCTAAGGAGGCTGAAGATAGG - Intergenic
1193208567 X:78778446-78778468 TTTTTAAGGAGGCTGATGATAGG + Intergenic
1193550043 X:82880563-82880585 TCTTTAAGGATGCTGAAAATAGG - Intergenic
1193791805 X:85823215-85823237 TTTTTAAGGAGGCTGAAGATAGG - Intergenic
1194121543 X:89969726-89969748 TTTTTAAGAATGCTGAGAATAGG + Intergenic
1194206132 X:91014182-91014204 TCTCTAAGGAGGCTAAAAATAGG + Intergenic
1194213660 X:91100470-91100492 TTTTTAATGAAGCATAGAATGGG - Intergenic
1194332779 X:92604220-92604242 TTTTTAATGAAGCTGATAAAAGG - Intronic
1194502116 X:94694321-94694343 TTTTTAGGGATGCTGAAAATAGG + Intergenic
1194705006 X:97164632-97164654 TTACTGAGAAAGCTGATAATAGG - Intronic
1195931128 X:110077758-110077780 TTTCTAAGGATGCTGAAAATAGG + Intronic
1196220005 X:113102711-113102733 TCTTTAAGAAAGCTGAAAATAGG + Intergenic
1197083679 X:122447825-122447847 TATATAAGGAAGCTAAAAATAGG - Intergenic
1197562829 X:128045918-128045940 TCTCTAAGGATGCTGAAAATAGG + Intergenic
1197572008 X:128161786-128161808 TCTTTAAGGAAGCTGAAGATAGG + Intergenic
1198277523 X:135110631-135110653 TCTTTAAGGATGCTGAAAATAGG + Intergenic
1198513068 X:137373747-137373769 TGTCTAAAGAGGCTGAGAAAAGG + Intergenic
1200031733 X:153302673-153302695 TTTCTAACAAAACTGAGAAAAGG + Intergenic
1200474399 Y:3627178-3627200 TTTTTAAGAATGCTGAGAATAGG + Intergenic
1200551889 Y:4588998-4589020 TCTCTAAGGAGGCTAAAAATAGG + Intergenic
1200641473 Y:5723264-5723286 TTTTTAATGAAGCTGATAAAAGG - Intronic
1200816380 Y:7537552-7537574 TTGCTGAAGAAGCTGAGAATGGG + Intergenic
1200983284 Y:9281574-9281596 TTTCTCAGGAAGCATAGACTTGG + Intergenic
1202127096 Y:21578123-21578145 TTTCTCAGGAAGCATAGACTTGG - Intergenic
1202152161 Y:21853399-21853421 TTTCTCAGGAAGCATAGACTGGG + Intergenic