ID: 1018705784

View in Genome Browser
Species Human (GRCh38)
Location 6:166462251-166462273
Sequence TGCCCCACCGGGGGTTCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 65}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018705784_1018705794 8 Left 1018705784 6:166462251-166462273 CCCATGGAACCCCCGGTGGGGCA 0: 1
1: 0
2: 0
3: 6
4: 65
Right 1018705794 6:166462282-166462304 GGCTCTGCCTGGCTTCCTACAGG 0: 1
1: 1
2: 1
3: 22
4: 207
1018705784_1018705793 -3 Left 1018705784 6:166462251-166462273 CCCATGGAACCCCCGGTGGGGCA 0: 1
1: 0
2: 0
3: 6
4: 65
Right 1018705793 6:166462271-166462293 GCAGGGCTGCAGGCTCTGCCTGG 0: 1
1: 0
2: 5
3: 75
4: 569

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018705784 Original CRISPR TGCCCCACCGGGGGTTCCAT GGG (reversed) Intronic
900962913 1:5937116-5937138 TGCCACACCTGGGGTTTCCTCGG + Intronic
901788150 1:11638238-11638260 TGCTCAACCTGGGGTTCCCTGGG + Intergenic
902515079 1:16985831-16985853 AGCCCCCCAGGGGGTTCCAGGGG + Intergenic
1070890829 10:79941356-79941378 TGCCCCAGCGGGGCTTCCCTGGG + Intronic
1071238671 10:83679416-83679438 TGCCCCACAGAGGGTCCCATGGG + Intergenic
1073206034 10:101769928-101769950 TGCCCCACCTGGGGGTGCAGTGG + Intergenic
1073485924 10:103819268-103819290 TGCCTCTCCTGGGGTTCCCTGGG - Intronic
1076722467 10:132398719-132398741 TCCCACGCCGGGGGTCCCATCGG - Intronic
1077034078 11:486463-486485 TGCCCCACCAGGATTTCCCTGGG + Intronic
1078341363 11:10499870-10499892 TGCCCCTTCGGAGCTTCCATAGG - Intronic
1083178718 11:60970856-60970878 TGCTCCACAGGGAGTACCATGGG + Intergenic
1083262809 11:61532334-61532356 TGCCCCCCTGGGGGCACCATGGG + Intronic
1085825144 11:79839401-79839423 TGCCTAACTGGGGGTCCCATGGG - Intergenic
1088528790 11:110785931-110785953 TGCCCCAGTGGGGTCTCCATGGG - Intergenic
1090700390 11:129289835-129289857 TGCACCACTGGGAGTTCCACAGG + Intergenic
1105426824 13:20301724-20301746 AGCCCCTCCGCGGGTCCCATGGG + Intergenic
1108263477 13:48681138-48681160 GGCCCCACAGGGGGCTACATGGG - Intronic
1111838819 13:93424074-93424096 TGCCCCATGGTGGGTTCCCTGGG + Intronic
1118796998 14:69152904-69152926 TGTCCCAGCGGGGCTTGCATGGG - Exonic
1121331489 14:93052553-93052575 TACCCCACTGGGGGTTCCTTTGG - Intronic
1126108373 15:45161741-45161763 TGACCCACCTGCGGTTCCAGCGG + Exonic
1143781612 17:9232259-9232281 TGCCCCAGCTGGGGTGCCCTCGG - Intronic
1144748369 17:17631238-17631260 TGCCCCTTTTGGGGTTCCATAGG + Intergenic
1145734590 17:27218449-27218471 GGCCCAACTGGGGGCTCCATTGG + Intergenic
1150280575 17:63927777-63927799 TGCCCCACCTGGAATTCCAGAGG + Intergenic
1151395673 17:73821142-73821164 TGCCCCACGTGGGGTTTCACTGG - Intergenic
1158703765 18:59772102-59772124 TGCCCCTCTGGGGCTTCCAGAGG + Intergenic
1165665229 19:37622217-37622239 TGCCCCTCCGTGCTTTCCATTGG + Intronic
1165744294 19:38221654-38221676 TGCCCCACCAAGGGTCCCAGTGG - Intronic
1167593412 19:50416062-50416084 TCCCCAGCCGGGGGTTCCCTTGG + Intronic
925003936 2:427034-427056 TGGCACGCCGGGGGTTCCGTTGG + Intergenic
926483934 2:13432274-13432296 TGCCCCAGTGGGGATTCCATGGG + Intergenic
935328857 2:101961889-101961911 AACCCCACAGGGGGTCCCATGGG - Intergenic
936626104 2:114151129-114151151 TGCCCCACAGGGAGTTCAAAAGG - Intergenic
937271262 2:120654550-120654572 TGCCCCACCGCCGCGTCCATTGG - Intergenic
938497506 2:131808203-131808225 TGTCCCACAGGGTGTTCCCTTGG - Intergenic
945045126 2:205775055-205775077 TGCCCCAGCAGGGGAGCCATGGG - Intronic
1174541566 20:51293566-51293588 TTCCCCTTCGGGGGCTCCATGGG - Intergenic
1176000128 20:62827936-62827958 GGCCACTCCGGGGGTTCCCTTGG - Exonic
1176293739 21:5059621-5059643 TGCTCCACAGGGGGTACCAGTGG + Intergenic
1179863520 21:44204027-44204049 TGCTCCACAGGGGGTACCAGTGG - Intergenic
1180192537 21:46172953-46172975 TCCCCCAGCTGGGGTTCCAGAGG - Intronic
1184684068 22:46088100-46088122 CCCCCCACCGTGGTTTCCATGGG - Intronic
950665211 3:14491223-14491245 TGTCCCACCAGGGGTTGCAGTGG - Exonic
952816823 3:37453210-37453232 TGCCCCACCGGCGGTGTCACTGG - Intronic
952820652 3:37483047-37483069 TGCCCCACCGGTTGTTCCAGAGG - Intronic
961779699 3:129314527-129314549 TGCCCCCACAGGGGGTCCATCGG - Intergenic
969233863 4:5851582-5851604 TGCCCCACTGGGGATCCCAATGG - Intronic
977853988 4:101865449-101865471 GACCCCACCAGAGGTTCCATGGG - Intronic
978423243 4:108556407-108556429 TGCCCCAATGGCTGTTCCATAGG + Intergenic
983219643 4:165032046-165032068 TGCGCCCCGCGGGGTTCCATGGG + Exonic
1001406524 5:171480999-171481021 CGCCCCACCTGGGGCTCCACTGG + Intergenic
1003949589 6:11105346-11105368 TACACCACCAGGAGTTCCATTGG - Exonic
1005947095 6:30602666-30602688 TGGCCCACCAGGGCCTCCATGGG + Exonic
1008422044 6:51312354-51312376 TGCACCAATGGGGGTGCCATAGG + Intergenic
1015513237 6:134060120-134060142 TGCCCCACAGGGTCTTGCATGGG + Intergenic
1016733867 6:147454944-147454966 TGCCACACAGGGGCTTCAATAGG + Intergenic
1018705784 6:166462251-166462273 TGCCCCACCGGGGGTTCCATGGG - Intronic
1019153403 6:170023658-170023680 CGCCCCACCCGGGGTCCCCTCGG - Intergenic
1021106734 7:16646348-16646370 CGCCCCGCCGGGGTTTCCATCGG + Intronic
1025220018 7:57099463-57099485 TGCCCCAGCGGGTGCTCCCTGGG + Intergenic
1025651674 7:63475571-63475593 TGCCCCAGCGGGTGCTCCTTGGG - Intergenic
1032017191 7:128387818-128387840 TGCCCCACTCCGGGTTCCCTGGG + Intergenic
1047669064 8:127125089-127125111 TCCCCCACTGGGAGTTCCAAGGG + Intergenic
1048162612 8:132034879-132034901 TGTCCCACCTGGGTTTCCAGAGG + Intronic
1049015049 8:139914237-139914259 TGCCCCACAGGGAGTGCCAGAGG + Intronic
1049212998 8:141395350-141395372 TGCCCCACCTAGGGGTCCTTAGG - Intronic
1057211276 9:93202404-93202426 TGCCCCTCCGGCGCTTCCGTGGG + Intronic
1059398700 9:114055051-114055073 TGCCCAACCGTGCGTCCCATGGG + Exonic
1187788175 X:22917352-22917374 TGCTCCTCCGGGGCTTCCACTGG - Intergenic
1190337216 X:49269885-49269907 TGCCGCAGCGGGGGCTCCACAGG - Exonic
1196007435 X:110851378-110851400 TACCCCACCCTGGGTTCCTTGGG + Intergenic