ID: 1018708055

View in Genome Browser
Species Human (GRCh38)
Location 6:166477097-166477119
Sequence CTACCTGGCTCCAGCTCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 165}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018708048_1018708055 19 Left 1018708048 6:166477055-166477077 CCTGTGCAGGTGAAGGTGACTCT 0: 1
1: 0
2: 0
3: 15
4: 167
Right 1018708055 6:166477097-166477119 CTACCTGGCTCCAGCTCCGCAGG 0: 1
1: 0
2: 1
3: 16
4: 165
1018708052_1018708055 -5 Left 1018708052 6:166477079-166477101 CCCAGCGGGGTTTTCAGACTACC 0: 1
1: 0
2: 1
3: 4
4: 49
Right 1018708055 6:166477097-166477119 CTACCTGGCTCCAGCTCCGCAGG 0: 1
1: 0
2: 1
3: 16
4: 165
1018708047_1018708055 22 Left 1018708047 6:166477052-166477074 CCGCCTGTGCAGGTGAAGGTGAC 0: 1
1: 0
2: 2
3: 17
4: 177
Right 1018708055 6:166477097-166477119 CTACCTGGCTCCAGCTCCGCAGG 0: 1
1: 0
2: 1
3: 16
4: 165
1018708045_1018708055 26 Left 1018708045 6:166477048-166477070 CCGGCCGCCTGTGCAGGTGAAGG 0: 1
1: 0
2: 0
3: 19
4: 201
Right 1018708055 6:166477097-166477119 CTACCTGGCTCCAGCTCCGCAGG 0: 1
1: 0
2: 1
3: 16
4: 165
1018708053_1018708055 -6 Left 1018708053 6:166477080-166477102 CCAGCGGGGTTTTCAGACTACCT 0: 1
1: 0
2: 0
3: 7
4: 52
Right 1018708055 6:166477097-166477119 CTACCTGGCTCCAGCTCCGCAGG 0: 1
1: 0
2: 1
3: 16
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018708055 Original CRISPR CTACCTGGCTCCAGCTCCGC AGG Intronic
900203070 1:1419961-1419983 CAGCCTGGCTCCAGCTGCCCCGG + Intronic
900226130 1:1534406-1534428 CTGCCTGGCTCCTGCTGCCCCGG - Exonic
900402761 1:2479361-2479383 CTCCAGGGCTCCAGCGCCGCAGG - Intronic
900418764 1:2546676-2546698 CTACCGGCCTCCCACTCCGCGGG + Intergenic
900519599 1:3099164-3099186 CAACCTGGGTCCAGCACCCCAGG - Intronic
900949615 1:5850999-5851021 CTACCTGGCCTCAGCACCTCAGG + Intergenic
901654531 1:10761877-10761899 CTTCCTGATGCCAGCTCCGCAGG - Intronic
902079672 1:13812525-13812547 CTACCAGGCTCCAGCCACACTGG - Intronic
902217836 1:14945569-14945591 CGGCCCGGCTCCAGCTCCGGTGG + Intronic
902336274 1:15756714-15756736 TTACCTGCCTCCAGCACCCCAGG - Intronic
905206314 1:36344595-36344617 CTAGCTGGCTCCAGATGAGCTGG + Intronic
905256142 1:36686732-36686754 CTACCAGGCACCTGCTCCACAGG - Intergenic
905641925 1:39595970-39595992 CTCCCTGGCTCTAGCTACACTGG + Intergenic
912384638 1:109265169-109265191 CTACCTGGGTCCCTCTCTGCAGG + Exonic
913081223 1:115389046-115389068 CTTCCTGGCTGCAGCTTCGCAGG + Intergenic
916138722 1:161675361-161675383 CTCCCTGGCTCCAGTCCAGCCGG - Intronic
916212840 1:162372738-162372760 CTGCCAGGCTCCAGCTGGGCTGG - Intronic
917222880 1:172749901-172749923 CTCCCTGGCTGGAGCTCCTCAGG - Intergenic
918047820 1:180952094-180952116 CTACCTGGCTCCTGCTGCAAAGG - Intergenic
920421012 1:205833459-205833481 CTTCCTGGCTCCAGTGCAGCTGG - Intronic
920934185 1:210415900-210415922 CTACCTGCCTCCACCTCCCAAGG + Intronic
921937305 1:220806948-220806970 CTACCTGGCTCCAACAGCGTTGG + Intronic
922107765 1:222527187-222527209 CTAACTGGCATCAGCTCTGCTGG + Intronic
923035193 1:230280666-230280688 CTGCCTGGCTGGAGCTCCCCAGG - Exonic
923047729 1:230367875-230367897 CTACCAGACTCCCGCTCTGCAGG + Intronic
1065520624 10:26567406-26567428 CTCCCCGCCTCCTGCTCCGCCGG - Exonic
1067025251 10:42838528-42838550 TGTCCTGGCTCCAGCTACGCTGG - Intergenic
1075859472 10:125662201-125662223 TTTCCAGGCTCCAGCTCAGCAGG - Intronic
1075957801 10:126538945-126538967 GTTCCTGGCTCCAGCTCAGCTGG - Intronic
1076467109 10:130690534-130690556 CTTCATGGCTCCAGCTCTGCTGG + Intergenic
1076484459 10:130807230-130807252 CTCCCTGGGTCCACCTCCACAGG + Intergenic
1077260003 11:1612203-1612225 CTTCCTGTGTCCCGCTCCGCAGG + Intergenic
1081847545 11:46251786-46251808 CTTCATGGCTCCAGCTCCCTTGG + Intergenic
1083262063 11:61528497-61528519 CTTCCTGGCTGCAGCTTCCCTGG + Intronic
1084656464 11:70522635-70522657 TTACCCGGCTCCAGCTCCGCGGG + Intronic
1084747280 11:71181190-71181212 CTTCCTGCCTTCAGCTCAGCGGG - Intronic
1089170217 11:116506523-116506545 CTACCCCGCTCCAGCTTCCCTGG - Intergenic
1089399252 11:118155002-118155024 CCATCTGTCTCCAGGTCCGCAGG + Intergenic
1089537289 11:119168729-119168751 CTCCCTGCCTCCATCCCCGCGGG - Intronic
1089740464 11:120578694-120578716 CTGCCTGACTCCAGCTCCCAAGG - Intronic
1091305765 11:134535241-134535263 CTGCCTGGCTCCGGCCCCTCTGG - Intergenic
1092244403 12:6855508-6855530 CTACCGGGCGCCGGGTCCGCCGG - Exonic
1092650779 12:10632438-10632460 CCACTTGGCTCCAGCTACACTGG - Intronic
1095706445 12:45242298-45242320 CTACCAGGCTGCAGCCTCGCAGG + Intronic
1096103246 12:48981867-48981889 CTACCTCCCTCCCTCTCCGCGGG + Intergenic
1096873390 12:54608838-54608860 CTTCCTGGTTCCAGCTGCCCAGG - Intergenic
1101334529 12:103784626-103784648 CTCCCTGGCTCCAGCTTGCCTGG - Intronic
1102122198 12:110450284-110450306 GTACCTGGATCCTGCTCCTCTGG - Exonic
1103063110 12:117874977-117874999 CCTCCGGGCTCCAGCTCCGTCGG - Intronic
1104602104 12:130161452-130161474 CTCCTTGGCTGCAGCCCCGCAGG - Intergenic
1104653580 12:130556604-130556626 CTGCAAGGCTCCAGCTCCCCTGG - Intronic
1108753093 13:53468725-53468747 TTACCTGGGACCAGCTCCCCAGG - Intergenic
1113145637 13:107204209-107204231 CAACCTGCCTCCAGCTCACCTGG - Intronic
1115499358 14:34035697-34035719 CTAGCTGGCTCCAGCTGCCTTGG + Intronic
1120867038 14:89304283-89304305 TTCCCGGGCTCCAGCTCAGCAGG - Intronic
1121733844 14:96204723-96204745 CAGCCTGGCTCCAGCTGGGCAGG + Intronic
1122060250 14:99132298-99132320 CTTCCTGACTCCAGCTCCCCCGG - Intergenic
1123425875 15:20169984-20170006 TGTCCTGGCTCCAGCTACGCTGG - Intergenic
1123535107 15:21176508-21176530 TGTCCTGGCTCCAGCTACGCTGG - Intergenic
1124189806 15:27564864-27564886 CTCCCTGGCACCTGCACCGCAGG - Intergenic
1124685757 15:31780508-31780530 CTACCTGACTCCAGATCTGTGGG + Intronic
1125728506 15:41880304-41880326 CCACCTCTCCCCAGCTCCGCAGG - Exonic
1126469440 15:48992362-48992384 ATCCCTGGCTCCAGCACCTCAGG + Exonic
1129458144 15:75686638-75686660 CTTCCTGACTCCAGATCTGCTGG + Intronic
1129725642 15:77900244-77900266 CTTCCTGACTCCAGATCTGCTGG - Intergenic
1129977316 15:79833060-79833082 CATCCTAGCTCCAGCTCCCCAGG - Intergenic
1130405977 15:83602400-83602422 CTACCAGGCACCAGTTCTGCTGG - Intronic
1141767417 16:86067802-86067824 CTCCCTGGCTCCACCACCCCTGG - Intergenic
1141838108 16:86555870-86555892 CTCTCTGGCCCCAGCCCCGCGGG + Intergenic
1141894875 16:86953036-86953058 CTTTCTGGCTCCAGCTCCTGTGG + Intergenic
1142431616 16:90031543-90031565 CTCACTGGATCCAGCTCCTCTGG - Intronic
1144489973 17:15700128-15700150 CTTCCAGGCTCCAGCGCCGTAGG + Exonic
1144910988 17:18681831-18681853 CTTCCAGGCTCCAGCGCCGTAGG - Exonic
1145013421 17:19382326-19382348 CTGCCTGGCTCCAGCACCCCAGG + Exonic
1145938373 17:28727944-28727966 CTCCCGGGCTCCTGCTCTGCGGG - Intronic
1147667777 17:42159727-42159749 CTACCTGCCTCCAGGTCCTGGGG + Exonic
1148673776 17:49433023-49433045 CTTCATGGCTCCAGCTCTCCAGG + Intronic
1150484895 17:65536955-65536977 CTGCAGGGCCCCAGCTCCGCCGG + Exonic
1151460193 17:74249790-74249812 CCACCTGGCTGCAGCTGCACAGG - Intronic
1151852351 17:76698383-76698405 CCAGCTGGCGCCAGCTCCGGGGG + Intronic
1152274851 17:79350172-79350194 CTCCCTGGCTGCAGCTGCCCTGG + Intronic
1152938445 17:83153709-83153731 CTGCCTGCCTCCTGCCCCGCTGG + Intergenic
1153905749 18:9659741-9659763 CTTCCTGACTCCGGCTCCTCCGG - Intergenic
1156907246 18:42368620-42368642 GTACCTGACTCCAGCTGAGCAGG - Intergenic
1157397467 18:47354903-47354925 TTACCTGGCTCCTGCCCCACAGG - Intergenic
1157751235 18:50180177-50180199 ATCACTGGCTCCAGCTCCTCAGG - Intronic
1160665766 19:327448-327470 CTAACTGTCTCCAGCTCTGGTGG - Intronic
1160749717 19:728087-728109 CTTCCTGGCGCCAGCCCAGCTGG + Intronic
1160950987 19:1667362-1667384 CCACCTCCCTCCAGCTGCGCTGG + Intergenic
1166043568 19:40217057-40217079 CTACCTAGAAGCAGCTCCGCGGG + Intronic
1166377529 19:42336069-42336091 CCACCTGCCTCCAGCTCCTCGGG + Exonic
1167438033 19:49491157-49491179 CTGCCAGGCTCCAGGTCCCCAGG - Intronic
927156789 2:20225262-20225284 CTGCTTGGCTCCCGCTCCTCCGG + Exonic
929221347 2:39467803-39467825 CTACGTGCCTCCAGCTCACCTGG - Intergenic
932144573 2:69306647-69306669 CGTCCTGGCTCCAGCTACGGAGG + Intergenic
933961867 2:87411896-87411918 TTGGCTGGCTCCAGCTGCGCTGG - Intergenic
934534563 2:95122056-95122078 CTAGCTGGCTCCTGCAGCGCCGG + Intronic
937901703 2:127024925-127024947 CAGCCTGTCTCCAGCTCCGGCGG - Intergenic
944220773 2:197302124-197302146 CTCCTTGGCTCCAGCCCCACTGG - Intronic
944517386 2:200526114-200526136 CTCCCTTGCTCCATCTTCGCAGG + Intronic
946679018 2:222194114-222194136 CTACCTGGCTCTCTCTCTGCAGG + Intergenic
947987948 2:234465036-234465058 CAACCTGGCTCCAGCACTGCTGG - Intergenic
1169262763 20:4149707-4149729 CCCCCTGGCGCAAGCTCCGCGGG - Intronic
1171247185 20:23621056-23621078 CTGCCAGGCTGCAGCTCCGCAGG + Intergenic
1171391357 20:24803515-24803537 CTACCTGGCACCAGGTCTGGAGG + Intergenic
1173868968 20:46330150-46330172 CCACCTGCCTCCAGCTCCCCTGG - Intergenic
1175738060 20:61400774-61400796 CGGCCTGGCCCCACCTCCGCTGG + Intronic
1175871290 20:62210662-62210684 CTGCCTGGCTGCAGCTCAGCAGG - Intergenic
1176199756 20:63854984-63855006 TGACCTGGCGCCAGCTCCCCAGG + Intergenic
1178764766 21:35439970-35439992 CTACCACACTCCAGCTCCCCTGG + Intronic
1179710194 21:43208886-43208908 CTACCTGCCCCCGGCTCTGCGGG + Intergenic
1179962961 21:44781206-44781228 CTTCCCGTCTCCAGCTCAGCTGG - Intronic
1180074202 21:45454550-45454572 CTGCCTGGCTCCACCTCTGATGG + Intronic
1182033714 22:27181223-27181245 CCACCTGGCTGCAGCTCAGATGG + Intergenic
1183608633 22:38882581-38882603 CCACTCGGCTCCAGCCCCGCTGG - Intergenic
1184074046 22:42164890-42164912 CTGGCTGCCTCCAGCTCCTCAGG - Intronic
1184757446 22:46524992-46525014 CTACCAGGCCCCAGGTCCACAGG + Intronic
1184878567 22:47290830-47290852 CTACCTGGCTGCAGCTGTGCTGG - Intergenic
1185132111 22:49045090-49045112 CTGCCTGCCTCCAGCTCCATGGG + Intergenic
949511927 3:4773723-4773745 CTGCCTTGCTCCAGCTCCTCAGG - Intronic
950143180 3:10629240-10629262 TCACCTGGCTCGACCTCCGCTGG + Intronic
950305336 3:11912131-11912153 CTACAGGGCTCCAGCTCCTTGGG - Intergenic
950359620 3:12441143-12441165 CTTCCTGGCTCCAGCCCATCTGG - Intergenic
954410489 3:50368505-50368527 CTATCTGGGTCCAGCTACACCGG - Intronic
960704496 3:120468989-120469011 CAGCCTGGCTTCAGCTCAGCAGG + Intergenic
960705594 3:120477822-120477844 CAGCCTGGCTTCAGCTCAGCAGG - Intergenic
962202404 3:133412652-133412674 CTACCAAGCGCCAGCTCTGCCGG + Intronic
962320219 3:134383860-134383882 CCACCTGCCTCCACCTCCGAAGG + Intergenic
962362827 3:134756019-134756041 CAACCTGCCTCCAGCCCCTCTGG - Intronic
962974180 3:140431734-140431756 ATACCTAGCTCCATCTCCACTGG - Intronic
968067107 3:195764773-195764795 ATACCTGGCTCCACATCCCCAGG - Intronic
968979080 4:3837046-3837068 CTACCAAGCTCCATCTCCCCAGG + Intergenic
969256848 4:6008140-6008162 CCACCGAGCGCCAGCTCCGCGGG - Intergenic
979311543 4:119209845-119209867 CTACTGGGTTACAGCTCCGCAGG + Intronic
979462688 4:121001734-121001756 CCACCTGGCTGCAGCCTCGCAGG + Intergenic
981778087 4:148393587-148393609 CTACTTAGCTCCAGCTCCTCAGG + Intronic
989456184 5:41646983-41647005 CATCCTTGCTCCAGCTCCACTGG + Intergenic
990541056 5:56772568-56772590 CTTCCTGGTTTCAGCTCTGCAGG - Intergenic
992187261 5:74256280-74256302 CCACCTGGCTCCATCTCCCATGG + Intergenic
992939949 5:81751526-81751548 CGCCACGGCTCCAGCTCCGCCGG - Intronic
1001495913 5:172187788-172187810 CAGCCTGGCTCCGGCTCCGAGGG - Intronic
1001930296 5:175668168-175668190 CTGCCTTCCTCCAGCTCCCCAGG - Intronic
1002000068 5:176192365-176192387 CGAGCTGGCCCCAGCTCCTCTGG + Intergenic
1002023943 5:176384165-176384187 CACCCTGGCTCCAGCTTCACTGG + Exonic
1003034896 6:2633865-2633887 CTGCCTGGCTCCAGCACAGCCGG - Intronic
1003838143 6:10093237-10093259 CTGCATGGCTCCAGCTCCCATGG + Intronic
1006518830 6:34559856-34559878 CTTCCTGCCTCCAGCTCCCTGGG + Intergenic
1007257514 6:40539148-40539170 CTACCTGGCCTCACCTCTGCAGG + Intronic
1015075943 6:129157882-129157904 CTACCTGGCTCCAGAAGTGCTGG - Intronic
1017719760 6:157236236-157236258 GTCCCTGCCGCCAGCTCCGCCGG - Intergenic
1018708055 6:166477097-166477119 CTACCTGGCTCCAGCTCCGCAGG + Intronic
1025023393 7:55497151-55497173 CCAGCTGCCTCCAGCTCCTCTGG - Intronic
1029709930 7:102293882-102293904 CTGCCTGGCACCAACTCAGCTGG + Intronic
1035761955 8:2074991-2075013 CCACCTGCCTCCAGCTCCAGTGG + Intronic
1035770533 8:2143332-2143354 TTACATGGCTCCTGCTCCGTGGG + Intronic
1043197978 8:77324385-77324407 CTACCTGGATTCAGCTTCACTGG + Intergenic
1046679029 8:117147006-117147028 CCTCCTGACTCCAGCTCCTCTGG - Exonic
1048006364 8:130422446-130422468 CTTCCTGGCTCCTGCTCCCTGGG + Intronic
1048326884 8:133446783-133446805 CTCCCTTGCTCCTGCTCCGTGGG - Intergenic
1048732923 8:137463805-137463827 GTACATTGCTCCAGCTGCGCTGG - Intergenic
1049213325 8:141396588-141396610 CCACTTGGCGCCAGCTCCTCGGG - Intronic
1050418850 9:5441167-5441189 CTCCATGGCTCCAGCTCCATGGG + Intergenic
1057220845 9:93257040-93257062 GTACCTGGCTCCAGCCTCCCAGG + Exonic
1057299737 9:93870929-93870951 CTCCCTGGCTCCCTCTCCCCCGG + Intergenic
1058798847 9:108525224-108525246 CTACCTGTCTTCTGCTCCACTGG + Intergenic
1061581611 9:131540538-131540560 CCACCTGGCTCCAGTGCCGTCGG + Intergenic
1061873976 9:133534899-133534921 CTACCTGGCTTCGGGTCAGCAGG - Intronic
1061884250 9:133583667-133583689 CCGCCTGGCTGCAGCTCCTCTGG + Intronic
1061951290 9:133937741-133937763 CTCCCTGACTCCAGCCCAGCAGG + Intronic
1062096599 9:134706963-134706985 CTACCTGGCTGCTGATCCGGAGG + Intronic
1062465378 9:136678468-136678490 CCTCCTGGCTCCATCCCCGCCGG - Intronic
1188540852 X:31248830-31248852 CTTCCTGGCTCCAGCTCCCTCGG + Intronic
1189500406 X:41551204-41551226 GTACATGGCTTCAGCTCCCCTGG + Intronic
1191675200 X:63785516-63785538 CTGCCTGCCTCCCGCTGCGCTGG + Intronic
1192219613 X:69188468-69188490 CTTCCTGTCTCCAGCTCACCTGG - Intergenic
1196478726 X:116121197-116121219 CATCTTGGCTCCACCTCCGCTGG - Intergenic
1198150047 X:133899420-133899442 CTACCTTGTTCCAGCACCACAGG + Intronic
1200690767 Y:6305252-6305274 CTACCTGGCACAAGCTCCAAGGG - Intergenic
1200714278 Y:6520262-6520284 CTACCTGGCACTAGCTCTGAGGG + Intergenic
1201019544 Y:9640895-9640917 CTACCTGGCACTAGCTCTGAGGG - Intergenic
1201044505 Y:9869464-9869486 CTACCTGGCACAAGCTCCAAGGG + Intergenic
1201063600 Y:10069331-10069353 CTACCTGGCACAAGCTGCGAGGG - Intergenic
1202115765 Y:21467954-21467976 CTACCTGGCACAAGCTCCGAGGG + Intergenic